Hi seqanwers
I am working on Haloplex data
I doing comparisons between the same sample, with two different technologies, haloplex and Sureselect, I have found the following thing In the call variants step (picture)
A great number of discrepancies are found in the last nucleotide of a lot of reads n haloplex data
I check by sanger some of these positions , and the was negative.
That I am doing badly?
I hope that you could help me or someone of agilent.
In my bioinformatic pipeline , first I remove the haloplex adaptors on the two sides.
>PrefixPE/1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>PrefixPE/2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
with cutadapt and run in BWA-mem , and GATK best practices (don't remove duplicates)
all opinions are welcome.
Induivain
I am working on Haloplex data
I doing comparisons between the same sample, with two different technologies, haloplex and Sureselect, I have found the following thing In the call variants step (picture)
A great number of discrepancies are found in the last nucleotide of a lot of reads n haloplex data
I check by sanger some of these positions , and the was negative.
That I am doing badly?
I hope that you could help me or someone of agilent.
In my bioinformatic pipeline , first I remove the haloplex adaptors on the two sides.
>PrefixPE/1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>PrefixPE/2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
with cutadapt and run in BWA-mem , and GATK best practices (don't remove duplicates)
all opinions are welcome.
Induivain