Tweet
Does anyone have a trick or script to convert collapsed reads back to raw fasta reads? I need them in raw fasta to be able to map with bowtie.
a perl script maybe will do it?
a perl script maybe will do it?
-
-
What are collapsed reads? -
>1-1377297
tgtaaacatcctcgactggaagct
>2-783040
tttggcaatggtagaactcacact
>3-461345
tagcttatcagactgatgttgacaComment
-
This looks like fasta to me, I'm still not sure what "collapsed reads" mean.Originally posted by Palgrave View Post
You can add "-f" to your bowtie command for alignment of reads in fasta format.Comment
-
I'm guessing that what you have are miRNA reads, with all identical sequences "collapsed" and your definition line means >[miRNA-id]-[counts].Originally posted by Palgrave View Post
I'm also guessing that you are asking how to create a file that contains 1,377,297 copies of miRNA-1, 783,040 copies of miRNA-2, etc.
Is that what you want to do? If it is, please don't. It would be a waste of time and cpu cycles to have Bowtie map exactly the same sequence 1,377,297 times. Map each unique sequence just once and then account for sequence abundance in your downstream analysis.Comment
-
The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist on Modified Bases...Yesterday, 07:01 AM -
Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...04-04-2024, 04:25 PM
Comment