
Go Back   SEQanswers > Applications Forums > RNA Sequencing

Similar Threads
Thread Thread Starter Forum Replies Last Post
Bowtie2 for miRNA-Seq gkuffel Bioinformatics 2 05-26-2017 12:49 AM
mRNA and miRNA sequencing amrita308 Sample Prep / Library Generation 8 11-04-2016 01:33 AM
which kit(s) to use for peripheral blood mRNA/miRNA bjloftus Sample Prep / Library Generation 3 12-02-2015 01:58 AM
miRNA reads alignment with bowtie2 Ahaswer Bioinformatics 19 08-20-2015 05:10 AM
miRNA-mRNA interaction ChrisK Bioinformatics 1 02-25-2014 11:17 PM

Thread Tools
Old 08-02-2017, 09:00 AM   #1
Junior Member
Location: My head

Join Date: Aug 2017
Posts: 1
Default How to use mirna and mrna sequences in bowtie2?

I have two files.

1. An mrna file in which each line looks like -

NR_030382 chr1:100154611-100178513 tattaggttggtgcaaaagtaattgtggtttttgcctgtaaaag

2. An mrna file whose lines are like -

>hsa-miR-576-3p MIMAT0004796

Now if i am not wrong, the thing should be like this
> mrna is from 3'utr, so i need to reverse it since mirna is also from 3'
> now considering i am doing 6mer, i need to skip the first character from each sequence from mirna, then search the mrna file for the existence of its compliment

How do I achieve this using bowtie2 ?

Please consider the fact that I am just a regular computer programmer and this is my first time encountering anything related to bioinformatics. I think i'll be needing to do this for 7mer, 8mer and 7mer+a1 also.

P.S - This was of no help,
daddyodevil is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 09:28 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO