SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
how to check the primers specificity in a local computer angel-sakura General 2 05-19-2015 02:58 AM
Long primers for illumina sequencing aka Illumina/Solexa 10 10-29-2014 10:49 AM
strand-specificity in paired-end data arabidopsis Bioinformatics 6 05-30-2012 07:29 AM
Illumina Pair end primers and adaptors for multiplexing mimi_lupton Sample Prep / Library Generation 1 05-25-2011 07:57 AM
How to infer Illumina paired-end strand specificity from SAM output? David Harmin Bioinformatics 0 02-16-2011 08:34 AM

Reply
 
Thread Tools
Old 07-15-2017, 02:08 PM   #1
MaxNorkin
Junior Member
 
Location: Mainz

Join Date: May 2017
Posts: 3
Question 5' end of Illumina sequencing primers, specificity

Hello to everybody!

I am new in Illumina sequencing and have a question (apology if the answer is already somewhere here, but I could not find it)

I had a look on Illumina sequencing primers and the primers which used for library preparation (Nextera) (https://support.illumina.com/content...0002694-01.pdf, http://nextgen.mgh.harvard.edu/attachments/Nextera%20Protocol.pdf) and it seems that they have just 3' end complementarity (19 out of 38 nt). In theory 3' end part would be enough for specific Sequencing by Synthesis. Why do you need this non-complementary 5' tail then? Why don't make it shorter? Or am I just looking at some wrong sequences?

Here are the sequencing primers for the library prepared with Nextera Kit:
Nextera Read 1 Primer: 5′-GCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG-3′
Nextera Read 2 Primer: 5′-GCCTTGCCAGCCCGCTCAGAGATGTGTATAAGAGACAG-3′

Final product ends:
Fw: 5-AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG[GSP part]
Rev: 5- CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG[GSP part]

Attached there is a nicer picture

Thanks for help!
Attached Files
File Type: pdf Specificity of Illumina sequencing primers.pdf (118.1 KB, 21 views)

Last edited by MaxNorkin; 07-15-2017 at 02:11 PM.
MaxNorkin is offline   Reply With Quote
Old 07-19-2017, 10:21 AM   #2
ianakiev
Junior Member
 
Location: boston

Join Date: Feb 2014
Posts: 9
Default

Quote:
Originally Posted by MaxNorkin View Post
Hello to everybody!

I am new in Illumina sequencing and have a question (apology if the answer is already somewhere here, but I could not find it)

I had a look on Illumina sequencing primers and the primers which used for library preparation (Nextera) (https://support.illumina.com/content...0002694-01.pdf, http://nextgen.mgh.harvard.edu/attachments/Nextera%20Protocol.pdf) and it seems that they have just 3' end complementarity (19 out of 38 nt). In theory 3' end part would be enough for specific Sequencing by Synthesis. Why do you need this non-complementary 5' tail then? Why don't make it shorter? Or am I just looking at some wrong sequences?

Here are the sequencing primers for the library prepared with Nextera Kit:
Nextera Read 1 Primer: 5′-GCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG-3′
Nextera Read 2 Primer: 5′-GCCTTGCCAGCCCGCTCAGAGATGTGTATAAGAGACAG-3′

Final product ends:
Fw: 5-AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG[GSP part]
Rev: 5- CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG[GSP part]

Attached there is a nicer picture

Thanks for help!
You need these "Long" primers in order to be able to cluster/sequence. Cheers
ianakiev is offline   Reply With Quote
Old 07-19-2017, 12:50 PM   #3
MaxNorkin
Junior Member
 
Location: Mainz

Join Date: May 2017
Posts: 3
Default

Dear ianakiev, thanks for your reply! I am sorry, but I think you didn't get my question. I am asking about sequencing primers, not indexing primers. These ones:

Nextera Read 1 Primer: 5′-GCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG-3′
Nextera Read 2 Primer: 5′-GCCTTGCCAGCCCGCTCAGAGATGTGTATAAGAGACAG-3′

I didn't get why there are some strange non-complementary (to cDNA library sequences) letters at the 5'ends of these primers.


Anyway, it seems that these are wrong sequences, real sequencing primers should have the same sequence as transposes adapters (the sequence between GSP and Index). Well, it's an assumption because Illumina doesn't provide this information (according to our CF). I am wondering if somebody performed Sanger sequencing of these guys?
MaxNorkin is offline   Reply With Quote
Old 07-19-2017, 12:55 PM   #4
JoeKutch
Junior Member
 
Location: Philadelphia

Join Date: Oct 2016
Posts: 4
Default

I think what he's trying to say is that those are the sequences needed to actually bind the template to the oligonucleotide lawn on the flow cell.
JoeKutch is offline   Reply With Quote
Old 07-19-2017, 01:21 PM   #5
MaxNorkin
Junior Member
 
Location: Mainz

Join Date: May 2017
Posts: 3
Default

Oh.. I am sorry if I misunderstood. Now I'm stuck. Could you please give a hint how that would work? How sequencing primers could help to bind the template to flow cell?

I thought that cDNA molecules bind to the flow cell via P5/P7 adaptors which are located at the very end of template. These ones:

Final product ends:
Fw: 5’-AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG[GSP part]
Rev: 5’- CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG[GSP part]

(?_?)
MaxNorkin is offline   Reply With Quote
Old 07-19-2017, 07:21 PM   #6
JoeKutch
Junior Member
 
Location: Philadelphia

Join Date: Oct 2016
Posts: 4
Default

Sorry - it looks like I misunderstood, not you.

I think the added sequencing primer bases are meant to keep the Tm of the primer in the appropriate range for the sequencer. For example, when designing custom primers, you need to aim for a Tm above 60-65 (it varies a little by sequencer) to ensure that it anneals and doesn't melt away during synthesis.
JoeKutch is offline   Reply With Quote
Old 07-20-2017, 02:53 PM   #7
ianakiev
Junior Member
 
Location: boston

Join Date: Feb 2014
Posts: 9
Default

The sequences in green colors are needed for hybridization to the flow cell primers. That is what I meant. Cheers
ianakiev is offline   Reply With Quote
Old 07-20-2017, 08:28 PM   #8
saurabhiitd
Junior Member
 
Location: San Diego

Join Date: Aug 2008
Posts: 1
Default Y shaped adaptors.

The reason they have such sequence this that during ligation or transposon based insertion. They will form a Y shaped fork.
>= XXXXXXXXXXXXXXXX =< where XXXXXXXXXXX is your insert
= represents the complementary sequence between Adaptor 1 and Adaptor 2 (highlighted in orange in your question). > and < represent two strands of Adaptor 1 and 2 which do not have complementarity.

Adaptor 1 may have the exact sequence for say Primer 1 whereas Adaptor 2 will have the reverse complementary sequence to Primer 2.
or
Adaptor 2 may have the exact sequence for say Primer 1 whereas Adaptor 2 will have the reverse complementary sequence to Primer 1.
Please look at the adaptor sequences and you would realize this.
I am not 100% about Nextera primers but this is a generally Illumina strategy for many sequencing kits.
saurabhiitd is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:57 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO