SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics


Reply
 
Thread Tools
Old 02-08-2010, 08:03 PM   #1
repinementer
Member
 
Join Date: Dec 2009
Location: asia
Posts: 57
Default MACS-ChIP seq-Error

Code:
Traceback (most recent call last):
  File "/home/taoliu/bin/macs", line 273, in <module>
    main()
  File "/home/taoliu/bin/macs", line 71, in main
    options.bg_redundant = bg_r (treat,options.max_dup_tags) # average
  File "/home/taoliu/bin/macs", line 225, in bg_r
    return float(total_duplicates)/(total_tags)
ZeroDivisionError: float division
I used the foolwing command and got above error. Is any one know what this is?
Code:
$ macs --format ELAND -t CMM028_191_unique_hits.txt -c CMM027_027_unique_hits.txt --name=CM28 --gsize=2473000000 --tsize=35 --mfold=25 --diag --wig
repinementer is offline   Reply With Quote
Old 02-08-2010, 10:26 PM   #2
Xi Wang
Senior Member
 
Join Date: Oct 2009
Location: Tsinghua, Beijing, China
Posts: 236
Default

First of all, you should check your Eland format, make sure it follows the following description, which is copied from MACS manual: http://liulab.dfci.harvard.edu/MACS/00README.html


Quote:
If the format is ELAND, the file must be ELAND output file, each line MUST represents only ONE tag, with fields of:

1. Sequence name (derived from file name and line number if format is not Fasta)
2. Sequence
3. Type of match: NM - no match found. QC - no matching done: QC failure (too many Ns basically). RM - no matching done: repeat masked (may be seen if repeatFile.txt was specified). U0 - Best match found was a unique exact match. U1 - Best match found was a unique 1-error match. U2 - Best match found was a unique 2-error match. R0 - Multiple exact matches found. R1 - Multiple 1-error matches found, no exact matches. R2 - Multiple 2-error matches found, no exact or 1-error matches.
4. Number of exact matches found.
5. Number of 1-error matches found.
6. Number of 2-error matches found. Rest of fields are only seen if a unique best match was found (i.e. the match code in field 3 begins with "U").
7. Genome file in which match was found.
8. Position of match (bases in file are numbered starting at 1).
9. Direction of match (F=forward strand, R=reverse).
10. How N characters in read were interpreted: ("."=not applicable, "D"=deletion, "I"=insertion). Rest of fields are only seen in the case of a unique inexact match (i.e. the match code was U1 or U2).
11. Position and type of first substitution error (e.g. 12A: base 12 was A, not whatever is was in read).
12. Position and type of first substitution error, as above.
__________________
Xi Wang
Xi Wang is offline   Reply With Quote
Old 02-08-2010, 10:51 PM   #3
repinementer
Member
 
Join Date: Dec 2009
Location: asia
Posts: 57
Default Yep. Thanx

Ya I found out my format is GERALD(-Illumina). Wasted almost 3 hours to convert GERALD to BED or ELAND. Still no result.

Found a perl script but it's for Solexa and Peakfinder package (Unfortunately jar files are not working (May be some Java file installation problems in my PC)).

Now writing my own script to modify the format......
repinementer is offline   Reply With Quote
Old 02-08-2010, 11:27 PM   #4
repinementer
Member
 
Join Date: Dec 2009
Location: asia
Posts: 57
Default

Could any one post GERALD format with simple text file and ELAND format with a simple text file.

Thanx
repinementer is offline   Reply With Quote
Old 02-08-2010, 11:30 PM   #5
repinementer
Member
 
Join Date: Dec 2009
Location: asia
Posts: 57
Default Is it GERALD format?

Code:
GERALD															
1	2	3	4	5	6	7	8	9	10	11	12	13	14	15
B2GA005	1	1	95	1341	615	0	1	TAGTAGAGGCCCCCAATGTGGTCCAAGATTCCCTA	ggggggggggggggggggggghggggegggggggg	chr1.fa		3000839	R	35	113
B2GA005	1	1	79	902	907	0	1	GAAAGGGACCACTGTGGGATGGAAGTGGACGTGAG	gdgdggdgbggfggfggceffeY^e[ecVYc]`]`	chr1.fa		3001342	R	26T8	71
B2GA005	1	1	47	804	221	0	1	TAGTGGGAACAAGCTGACAGCTCTGTGTTCTGCTT	ggggggggggggggggggggggggggggggggggg	chr1.fa		3001805	F	35	87
If it is. COuld you please explain the values in columns referring to? so that I could convert into ELAND

Last edited by repinementer; 02-09-2010 at 12:45 AM.
repinementer is offline   Reply With Quote
Old 02-09-2010, 12:44 AM   #6
repinementer
Member
 
Join Date: Dec 2009
Location: asia
Posts: 57
Default GERALD to BED..Script

But still not sure with F and R definitions I gave..

Code:
repine@pc499 ~/MACS-1.3.7.1
$ awk '$13 == "R" {print $11,"\t",$12+35,"\t",$12,"\t",$13,"\t",$1} $13 == "F" {print $11,"\t",$12,"\t",$12+35,"\t",$13,"\t",$1}' CMM027_027_unique_hits.txt |tr 'F' '+' |tr 'R' '-'|tr -d '.fa'
repinementer is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:06 AM.


Powered by vBulletin® Version 3.8.6
Copyright ©2000 - 2010, Jelsoft Enterprises Ltd.