SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Problems with BWA XA output on kbhit General 1 02-29-2012 02:16 PM
the output of bwa milkingroom Bioinformatics 1 09-21-2011 02:48 PM
Question on BWA output rboettcher Bioinformatics 3 04-18-2011 04:21 AM
BWA output interepretation seq_GA Bioinformatics 4 06-14-2010 01:23 AM
output all possible match using bwa mingkunli Bioinformatics 2 09-05-2009 09:06 AM

Reply
 
Thread Tools
Old 12-22-2010, 02:58 AM   #1
scami
Member
 
Location: italy

Join Date: Sep 2010
Posts: 55
Default bwa output

Hi guys

I run bwa on my ILLUMINA reads with the following commands:

Code:
./bwa aln vitis12xCHR.fasta  s_1_1_sequence.txt -e 5  -d 0 -i 0 -t 6 >s_1_1_sequence.sai


./bwa aln vitis12xCHR.fasta s_1_2_sequence.txt -e 5  -d 0 -i 0 -t 6 >s_1_2_sequence.sai


followed by

./bwa sampe vitis12xCHR.fasta s_1_1_sequence.sai s_1_2_sequence.sai s_1_1_sequence.txt s_1_2_sequence.txt >s_1_bwaAlgnment.sam

If I open the resulting sam file I get the following output:

Code:
..........................................
ILLUMINA-C3C24B_0047:3:120:18879:10724#0	141	*	0	0	**0	0	CTAGCCCTAATTAAATTTATGTGTGACAATGTGCAAAATTTAGCACATTCAACCACAAAACTTCTATGAAGAGGT	aaaa\aaaaa_aa_aaaaa\aaaa[YWWPPHNNFOWUZ[[`a]]aaaaa`Q]KY^____[X_XXR^BBBBBBBBB
ILLUMINA-C3C24B_0047:3:120:18879:7314#0	77	*	0	0	*	*00	AATACGCCAAAAGTCTCNTCTCCTAACTNNAANTGGCAAAACTGNNGCTGAAGCTCATCCACTCCCTCTATGTCA	bbbabbbbbbbbbbb^`E``aaaaaWZXEEOODOO^]]``WWZWEDOOOONOOOOba^bbbbbbbbab[bBBBBB
ILLUMINA-C3C24B_0047:3:120:18879:7314#0	141	*	0	0	*	*00	ATATGGCGCGTCTGCACCAGGAGAAAGTGAGAGCTTATCTGACTTGCACACTATTCGATTATCCTATAAATCCTT	bbbb`bbabbabbbbbbbbbbb`bbbbc`X^``U`Ybb_bb`aPa_b`V`a`a\]J]\_\`\^XO^[M]Ya[a_a
ILLUMINA-C3C24B_0047:3:120:18879:10603#0	77	*	0	0	**0	0	TGTATTATGCTTATTAANGTTGATGANTNNTTNAAAGTTCTATTNNATTCAACCTTATTTCTTCCACTTTAAGCT	bbbbbbabbbbbbbb``E``[[[[[OEODDNODOONNOOONNNNDDOOOOOOOOObbbbbbbbbbbb_bb`_a^b
ILLUMINA-C3C24B_0047:3:120:18879:10603#0	141	*	0	0	**0	0	CAAAGGCTCATTGGCCTTTTATAAGGCGTCCCAACACTATTAAAATGAGGTCAAAAGTACCAAGTCTAAATTTTC	bbbbbbbbbbbbbbbbbbbbbbb^b\J`[WFNMOO`O```abW[_a_\aa_aUT_GNKOOXWFRQ^\T\V_^^V^
ILLUMINA-C3C24B_0047:3:120:18879:6287#0	77	*	0	0	*	*00	AACGATTATGATAACGGNAAAGGTAANANNAANGGTAATGATGANNGTAACAGTCACGGTCACAGTAATAGTGAC	bbbbbbbbbbbbbbbaaEaaBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
ILLUMINA-C3C24B_0047:3:120:18879:6287#0	141	*	0	0	*	*00	CAGTTACCGTTACCGTCAATATAAACGTTACTATCACCGTTACCGTTATCGTCACCATTTCTATTACCGTCATCA	bbbbbbbbbabbbbbabb_bbbb_bbbab``bbbabbbbabbabaaaaaa]^aaaaa`aaa]aaZLZUUR`Z``^
ILLUMINA-C3C24B_0047:3:120:18879:15229#0	77	*	0	0	**0	0	AGAGGCCTCATGCATGGNTAGAAGATNCNNTGNGAGGAATCCAANNGAAAGAACATGACTAGCCTGCTGTTATAC	bbbbbbbbbbbbbbb^[E[[ONNNNNEODDNOENNZZX[YOOOODE]W]X``a__`bba[_b^__`Ua_[Z_\\Z
ILLUMINA-C3C24B_0047:3:120:18879:15229#0	141	*	0	0	**0	0	GAGAGCCTTCTCTAAGCTTCTTGGGTTGAGATTAGCTATTGAGTTGGAGATTCAAACCCTTTTGGAGGGATTGTA	bbbb^bbbbbbbbbbbZbbbbbbbbabbb`_b``bbbbbbbaa_aaabb_[a]ba_\bTaaa_a^YXX[[VTYTU
ILLUMINA-C3C24B_0047:3:120:18879:7980#0	77	*	0	0	*	*00	GTGGATTTGGTAGCTTANTTTTAAGANANNTTNAACAAATGAAANNGTTGTTTAGTTGCCCAACACACAATTTTT	_Y[_]_Z__BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
ILLUMINA-C3C24B_0047:3:120:18879:7980#0	141	*	0	0	*	*00	GTGGTTTAGCAAATGCTTCAGATGATGCTCGAAGATCGAGCCAGAGGCAGGCTATCTTTGTAGAAGACAACGCTG	XPRZJ]YQ[[`__\`````___```^]aaBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
ILLUMINA-C3C24B_0047:3:120:18879:9103#0	77	*	0	0	*	*00	GTTCCACTTTTGGAAGANCCTGCGTTNTNNCANCAGATCTTGATNNTTCATATATAAATGTAACTAATGTATCTC	bbbbbbbbbbbbbbbbbEbb^^^^^ODNDDNOEOO`^`^`NNOOEDOOOO`^^``bbbb``b\abbab`_bb`\_
ILLUMINA-C3C24B_0047:3:120:18879:9103#0	141	*	0	0	*	*00	TATTTGTGAAAATGTATGTATAGCCAAAAAAGGACCACACCTAAAATCAGGTCAAGTTCTAATTGTTCAAGTTGA	bbbcbbabbbbbbbbbbbbbbbbbbbbbbXHWFVXYYYY[^bb\b_\`bb__^b_\\``]bab^_``aaa_^Y__
ILLUMINA-C3C24B_0047:3:120:18879:8267#0	77	*	0	0	*	*00	AATGATAGAATGAAGAANTGCTCCCCNANNGTNTTCCGGACCTCNNTGTTGGGGGAGAAGGTCGCCGTGTTCTGT	bbbbbbbbbbbbbbbBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
ILLUMINA-C3C24B_0047:3:120:18879:8267#0	141	*	0	0	*	*00	ATTCGATTTCGCCTAAATTATAATTTATGATAATAAATATATCAATTTGATGATTTAAGTGCAACGCCTTTGGGG	bbbb^b`bbbbbbbbb_bbbbbbbbVVWUVLVWVW]VYY]bbbabbbb]baa\`a]`^````[\\`[Z``b_Y^B
................................
I thought I was supposed to have in each single line also the position on chromosome and the cigar field with the informaiton about snp and indels. Am I doing anything wrong?

thanks four your help
scami is offline   Reply With Quote
Old 12-22-2010, 03:10 AM   #2
drio
Senior Member
 
Location: 4117'49"N / 24'42"E

Join Date: Oct 2008
Posts: 323
Default

For those reads you are showing BWA could not find alignments. That's why you don't see the chrm or any other mapping information.

BWA will not call SNPs for you, it only find the best alignments for your short reads. You need a different tool to perform the SNP calling. The two most used tools are samtools (same author than BWA) and the GATK framework from the BI.
__________________
-drd
drio is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:20 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO