I am analyse my RNA-Seq on Galaxy.
FASTQC results showed me I have overrepresented reads. Many of them are "NNNNNN" and very short reads (<10 bp).
I am using Clip to remove them. (I know clip is for adapter removing and Adapter Content passed FASTQC. But, I cannot find other tools to do this.)
My question is what sequence I should type in the box of "Enter custom clipping sequence" in the Clip tool.
The adapter sequence is "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" from 5' to 3' before index.
Should I put the above whole sequence in the box or I just need to put the first several nucleotides?
FASTQC results showed me I have overrepresented reads. Many of them are "NNNNNN" and very short reads (<10 bp).
I am using Clip to remove them. (I know clip is for adapter removing and Adapter Content passed FASTQC. But, I cannot find other tools to do this.)
My question is what sequence I should type in the box of "Enter custom clipping sequence" in the Clip tool.
The adapter sequence is "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" from 5' to 3' before index.
Should I put the above whole sequence in the box or I just need to put the first several nucleotides?