SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
editing header files sasignor Bioinformatics 3 05-05-2014 02:00 PM
how to do a power analysis for diferential expression for miRNA-seq? PabloMarin-Garcia RNA Sequencing 1 10-14-2012 08:45 AM
miRNA-seq HiSeq2000 expression profiling problem mirandaseq Illumina/Solexa 5 06-16-2011 04:05 PM
miRNA-seq HiSeq2000 expression profiling problem mirandaseq Bioinformatics 0 06-09-2011 08:43 AM

Reply
 
Thread Tools
Old 11-11-2015, 09:08 AM   #1
na_sd
Junior Member
 
Location: USA

Join Date: Nov 2015
Posts: 3
Default miRNA-Seq files header and expression values

I have downloaded miRNA seq file from GSE31617
Files contain information like following:

hsa-let-7a-1 hsa-let-7a t0000020 25073 37013 5p TGAGGTAGTAGGTTGTATAGTT TGAGGTAGTAGGTTGTATAGTT S
hsa-let-7a-1 hsa-let-7a* t0059321 6 12 3p CTATACAATCTACTGTCTTTC CTATACAATCTACTGTCTTTC S
hsa-let-7a-2 hsa-let-7a t0000020 25073 37025 5p TGAGGTAGTAGGTTGTATAGTT TGAGGTAGTAGGTTGTATAGTT S
hsa-let-7a-2 hsa-let-7a-2* t1103419 1 1 3p CTGTACAGCCTCCTAGCTTTCC CTGTACAGCCTCCTAGCTTTCC S
hsa-let-7a-3 hsa-let-7a t0000020 25073 37128 5p TGAGGTAGTAGGTTGTATAGTT TGAGGTAGTAGGTTGTATAGTT S
hsa-let-7a-3 hsa-let-7a* t0059321 6 12 3p CTATACAATCTACTGTCTTTC CTATACAATCTACTGTCTTTC S
hsa-let-7b hsa-let-7b t0000335 3748 7938 5p TGAGGTAGTAGGTTGTGTGGTT TGAGGTAGTAGGTTGTGTGGTT S
hsa-let-7b hsa-let-7b* t0163422 2 2 3p CTATACAACCTACTGCCTTCC CTATACAACCTACTGCCTTCCC D
hsa-let-7c hsa-let-7c t0000721 2095 3068 5p TGAGGTAGTAGGTTGTATGGTT TGAGGTAGTAGGTTGTATGGTT S
hsa-let-7d hsa-let-7d* t0056459 6 18 3p CTATACGACCTGCTGCCTTTC CTATACGACCTGCTGCCTTTCT D
hsa-let-7d hsa-let-7d t0004262 320 767 5p AGAGGTAGTAGGTTGCATAGTT AGAGGTAGTAGGTTGCATAGTT S


First, I wanna know what is the header of columns? (files do not have any header line)
Second, I would like to calculate expression values for miRNAs, how can I do it?
Thanks

PS. I am new in miRNAseq files.
na_sd is offline   Reply With Quote
Old 11-11-2015, 09:15 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,800
Default

For ref Cross-posted: https://www.biostars.org/p/165320/

I am thinking that it is some sort of alignment format but the exact name is eluding me (and my google-fu for now). Hopefully some one else will be able to recollect.

Where exactly did you get that data file from on SRA?

Last edited by GenoMax; 11-11-2015 at 09:21 AM.
GenoMax is offline   Reply With Quote
Reply

Tags
mirna, rna-seq

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:18 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO