SEQanswers

Go Back   SEQanswers > General



Similar Threads
Thread Thread Starter Forum Replies Last Post
Threshold quality score to determine the quality read of ILLUMINA reads problem edge Illumina/Solexa 35 11-02-2015 10:31 AM
Quality Score: FastQC vs Illumina ericguo Illumina/Solexa 8 10-22-2015 04:08 AM
about illumina reads quality score gridbird Illumina/Solexa 4 08-08-2011 05:10 AM
Illumina quality score whereisshe Bioinformatics 3 11-26-2010 06:45 AM
Quality score threshold? chris Bioinformatics 8 04-29-2008 12:43 AM

Reply
 
Thread Tools
Old 09-13-2010, 06:55 AM   #1
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default Threshold quality score to determine the quality read of ILLUMINA reads problem

Hi,

Does anybody have idea regarding the general threshold average quality score to determine whether the ILLUMINA raw reads is good or bad quality?

Below is one of my ILLUMINA raw reads in fastq format:

@HWI-EAS001
AACATTCAACGCTGNCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC
+HWI-EAS001
^`Y^aa__^_]\`_B\U][RV`W`^`][``__Z^P[UUZZUUa^Z[^^Z[

The above reads got 50 nucleotide in length.
Is it got any program or script able to calculate the average quality score of above read?
My purpose is hope to calculate the average quality score of each read.
Based on the average quality score of each read, I plan to filter out those "low quality reads" that below threshold of average quality score.
Thanks a lot for any advice.
edge is offline   Reply With Quote
Old 09-13-2010, 02:22 PM   #2
svl
Member
 
Location: Netherlands

Join Date: Sep 2009
Posts: 43
Default

Maybe galaxy has what you're looking for:
http://main.g2.bx.psu.edu/

Or fastqc:
http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/

Or have a look at the wiki:
http://seqanswers.com/wiki/Special:B...uality_Control
svl is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:39 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO