SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Insert size != Fragment size? Boel Bioinformatics 6 12-12-2013 09:28 AM
Insert size billstevens Sample Prep / Library Generation 3 04-16-2012 04:33 AM
About Insert, Insert size and MIRA mates.file aarthi.talla 454 Pyrosequencing 1 08-01-2011 02:37 PM
insert size polystone Sample Prep / Library Generation 0 05-04-2010 11:07 AM
insert size adrian Bioinformatics 1 03-18-2010 05:55 PM

Reply
 
Thread Tools
Old 06-18-2012, 03:09 PM   #1
camelbbs
Member
 
Location: United States

Join Date: Jun 2011
Posts: 49
Default the insert size in rnaseq

HI I have paired-end rnaseq data in sam files like this:

Code:
DJG84KN1:219:D0R66ACXX:7:1103:17826:20428	147	chr10	158214	255	95M	=	158144	-165	CTCAAAGAGAAAGCTGTAACTGCTGTTATGTGTCACATACCAAGTTGGAATCCATTTGCCACAGTCTAGGTGACCTCAGCTCACACCTGAGTGGA	DDEEEEEEEFFFFFFHHHHHHJJJJJJJJJJJIJJJJIGJJJIHFJJJJJIJJJJJJJJHEJJJJJJJJJJJGJJJJJJJIIHFCHHFFFFFCCB	XA:i:0	MD:Z:95	NM:i:0
can I ask how much is the insert size (or inner distance)?

Last edited by camelbbs; 06-18-2012 at 03:12 PM.
camelbbs is offline   Reply With Quote
Old 06-21-2012, 07:00 AM   #2
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,238
Default

Technically the "-165" should be the insert size. Well, the absolute value of -165. So "165 bp" is the answer. However this is especially problematic for RNA as you may be mapping cDNA reads derived from spliced mRNA back to genomic DNA. So if your read pairs happen to flank an exon junction or two, you would need to subtract the intron lengths to get the right (or approximately right) answer.

--
Phillip
pmiguel is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:01 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO