SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Illumina/Solexa Genome Analyzer Primer/Adapter Sequences ECO Illumina/Solexa 145 05-30-2016 07:05 AM
Improved Protocols for the Illumina Genome Analyzer Sequencing System Chien-Yuan Chen Literature Watch 3 12-24-2014 01:46 PM
Solid vs Illumina Genome Analyzer pinki999 General 1 10-06-2010 07:34 AM
what's the different between Illumina Genome Analyzer biocc Illumina/Solexa 3 06-03-2010 11:28 PM
A clarification for Illumina/Solexa Genome Analyzer Primer/Adapter Sequences kaichen Illumina/Solexa 1 08-06-2009 05:57 PM

Reply
 
Thread Tools
Old 08-06-2010, 01:54 AM   #1
NicoBxl
not just another member
 
Location: Belgium

Join Date: Aug 2010
Posts: 263
Default trim adapter from Illumina Genome Analyzer IIe miRNA reads

Hi everybody,

I can't find the sequence of the adapter from Illumina's Genome Analyzer II. I've received reads ( 36 nt each sequence ) to detect new miRNA from an ovin model.

I've found the function trimLRPatterns in R but I need the sequence to trim.

Can someone help me

Thanks a lot,

N.
NicoBxl is offline   Reply With Quote
Old 08-08-2010, 11:24 PM   #2
NicoBxl
not just another member
 
Location: Belgium

Join Date: Aug 2010
Posts: 263
Smile

nobody knows ?

it will help me a lot.

Thanks
NicoBxl is offline   Reply With Quote
Old 08-09-2010, 07:44 AM   #3
yjhua2110
Member
 
Location: china

Join Date: Nov 2009
Posts: 63
Default

Quote:
Originally Posted by NicoBxl View Post
nobody knows ?

it will help me a lot.

Thanks
You can try clipRead program at our deepBase database ( http://deepbase.sysu.edu.cn/ ), which were developed to discover small and long ncRNAs from deep-sequencing data.

you can download clipRead program at http://deepbase.sysu.edu.cn/clipRead/. More detailed information, please see the readme file ( http://deepbase.sysu.edu.cn/clipRead/readme.txt ).

Last edited by yjhua2110; 08-09-2010 at 07:47 AM.
yjhua2110 is offline   Reply With Quote
Old 08-09-2010, 08:49 AM   #4
NextGenSeq
Senior Member
 
Location: USA

Join Date: Apr 2009
Posts: 482
Default

See
http://seqanswers.com/forums/showthread.php?t=198&highlight=sticky


It should be a sticky but doesn't "stick" to the top
NextGenSeq is offline   Reply With Quote
Old 08-11-2010, 11:19 PM   #5
NicoBxl
not just another member
 
Location: Belgium

Join Date: Aug 2010
Posts: 263
Default

thanks, I found the adapter I expect

3'RNA adapter : UCGUAUGCCGUCUUCUGCUUGU

In my fastq file, I've got about 19M reads. When I sort the reads on the number of occurences, I found that the sequence with the most important occurence is :

adapter

TCGTATGCCGTCTTCTGCTTGTAAAAAAAAAAAAAA (I remplace U by T)

and the next sequence in the list are similar (It seems that one mismatch appears in the 3! part of the reads )

I found some other reads with high occurence like that :

adapter in green and a mismatch in the adapter seq in red

TCGTATGCCGTCTTCTGCTTGTAAAAAAAAAAAAAA

and even ( just a part of the adapter is present, the N represent an non-readable nucleotide )

AGTACAGTCTCGTATGCCGTCTNNNNNNNNN

the last example appears even with mismatches.

what is the best method to trim this adapter ?

Thanks
NicoBxl is offline   Reply With Quote
Old 01-02-2014, 05:31 AM   #6
xiaoxiaodong2013
Junior Member
 
Location: kuopio

Join Date: Oct 2013
Posts: 2
Default

hellö, I have the same problem now, then how did you deal with finally?
xiaoxiaodong2013 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:05 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO