QIAseq FX DNA Library Kit adapters for trimming

ciemanek · 10-23-2019, 05:31 AM

Can anyone point me to the sequences of QIAseq FX DNA Library Kit for adapters trimming in preprocessing? Illumina has exact sequences for trimming included in their manual, but I can't seem to find the same information in Qiagen's resources. Any suggestions on where to find them?

GenoMax · 10-23-2019, 05:42 AM

Do a google search with "QIAseq FX DNA". Second link in that search should be a PDF file with title "QIAGEN® QIAseq FX DNA Library Kit Handbook". Check Appendix C in that file for sequences.

Addendum : Those are just index/barcode sequences.

ciemanek · 10-28-2019, 02:19 AM

Thank you - this is a piece of information I have already: I succesfully demultiplexed my samples and now want to run QC and preprocessing, so I would need sequences of adapters to trim. Illumina provides adapters sequences in their manual (like here) and I can't find a piece of corresponding information for Qiagen.

nucacidhunter · 10-29-2019, 12:57 AM

The library is sequenced on Illumina system so the adapter sequences for trimming should be the same as Illumina adapters.

ciemanek · 10-29-2019, 02:19 AM

Thanks a lot - I just ran FastQC on my samples and it indeed indicated that Illumina adapters are present. However, it's not clear to me which Illumina adapters sequences should I use for trimming - would it be ie TruSeq Universal Adapter or some others? How can I determine that? Or is it a piece of information that my lab should be able to provide me with?

I tried to run BBmerge to determine adapters sequences but it didn't seem very informative (produced mostly N's).

GenoMax · 10-29-2019, 04:14 AM

You may not have any adapters present if your inserts were of a good size and there was no read-through.

BBMap suite provides an adapters.fa file in the "resources" directory. You can use it to scan your sequences using bbduk.sh. It contains adapter sequences for many commonly used library kits.

nucacidhunter · 10-29-2019, 04:22 AM

It should be TruSeq as FastQC would indicate. I am not sure but you can try following:

Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

ciemanek · 10-29-2019, 04:44 AM

Thanks a lot!

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
Compatibility of QIAseq FX DNA library prep kit for Illumina miseq	djung	Illumina/Solexa	2	06-15-2019 11:10 AM
Unable to do library amplification using the new Nextera DNA Flex Library Prep kit	Rosmano	Sample Prep / Library Generation	1	04-03-2019 03:04 AM
Adapters for Nextera Mate Pair Library Prep Kit	lu_Ste	Illumina/Solexa	1	10-10-2018 10:30 PM
QIAseq 1-Step Amplicon Library kit-reviews?	Buckethead84	Sample Prep / Library Generation	1	09-09-2017 03:28 AM
which library kit; are adapters on Illumina PCR free LT kit biotinylated ?	Lovro	Sample Prep / Library Generation	0	06-08-2016 05:28 AM

10-23-2019, 05:31 AM	#1
ciemanek Junior Member Location: Cracov, PL Join Date: Jul 2019 Posts: 5	QIAseq FX DNA Library Kit adapters for trimming Can anyone point me to the sequences of QIAseq FX DNA Library Kit for adapters trimming in preprocessing? Illumina has exact sequences for trimming included in their manual, but I can't seem to find the same information in Qiagen's resources. Any suggestions on where to find them?

10-23-2019, 05:42 AM	#2
GenoMax Senior Member Location: East Coast USA Join Date: Feb 2008 Posts: 7,082	Do a google search with "QIAseq FX DNA". Second link in that search should be a PDF file with title "QIAGEN® QIAseq FX DNA Library Kit Handbook". Check Appendix C in that file for sequences. Addendum : Those are just index/barcode sequences. Last edited by GenoMax; 10-23-2019 at 05:48 AM.

10-28-2019, 02:19 AM	#3
ciemanek Junior Member Location: Cracov, PL Join Date: Jul 2019 Posts: 5	Thank you - this is a piece of information I have already: I succesfully demultiplexed my samples and now want to run QC and preprocessing, so I would need sequences of adapters to trim. Illumina provides adapters sequences in their manual (like here) and I can't find a piece of corresponding information for Qiagen.

10-29-2019, 12:57 AM	#4
nucacidhunter Jafar Jabbari Location: Melbourne Join Date: Jan 2013 Posts: 1,238	The library is sequenced on Illumina system so the adapter sequences for trimming should be the same as Illumina adapters.

10-29-2019, 02:19 AM	#5
ciemanek Junior Member Location: Cracov, PL Join Date: Jul 2019 Posts: 5	Thanks a lot - I just ran FastQC on my samples and it indeed indicated that Illumina adapters are present. However, it's not clear to me which Illumina adapters sequences should I use for trimming - would it be ie TruSeq Universal Adapter or some others? How can I determine that? Or is it a piece of information that my lab should be able to provide me with? I tried to run BBmerge to determine adapters sequences but it didn't seem very informative (produced mostly N's).

10-29-2019, 04:14 AM	#6
GenoMax Senior Member Location: East Coast USA Join Date: Feb 2008 Posts: 7,082	You may not have any adapters present if your inserts were of a good size and there was no read-through. BBMap suite provides an adapters.fa file in the "resources" directory. You can use it to scan your sequences using bbduk.sh. It contains adapter sequences for many commonly used library kits.

10-29-2019, 04:22 AM	#7
nucacidhunter Jafar Jabbari Location: Melbourne Join Date: Jan 2013 Posts: 1,238	It should be TruSeq as FastQC would indicate. I am not sure but you can try following: Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

10-29-2019, 04:44 AM	#8
ciemanek Junior Member Location: Cracov, PL Join Date: Jul 2019 Posts: 5	Thanks a lot!