SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Using split/merge .bams for Cufflinks DerSeb Bioinformatics 2 03-15-2012 10:42 AM
Error in samtools merge; different target sequence name Fumumumu Bioinformatics 1 01-26-2011 05:22 AM
how to define nonsense mutation yuanzhi Bioinformatics 16 12-01-2010 10:28 AM
samtools merge error underestimating the sequence counts Seq1234 Bioinformatics 0 11-22-2010 02:42 PM
Mosaik Merge Error amcrisan Bioinformatics 1 11-11-2009 01:05 PM

Reply
 
Thread Tools
Old 07-29-2010, 12:07 PM   #1
Daniel
Junior Member
 
Location: Detroit,MI

Join Date: Jul 2010
Posts: 7
Default Cufflinks error - nonsense gene merge

Hello All,
I am new to bioinformatics and am (trying to) use Cufflinks for the first time. My input to Cufflinks is an accepted_hits.sam file with ~19 million reads - generated (apparently without error) from Tophat. When I run cufflinks (cufflinks -o Results accepted_hits.sam) I first get a "Counting hits in map" message, and then "Error:nonsense gene merge. Exiting". By an iteriative process of truncating my input file, I find that Cufflinks apparently does not like a line (~ 4 millionth) in the input file.

My accepted_hits.sam file at the error point looks like this (below). Shown are 9 reads - Cufflinks seems to generate the error message with 6th read shown. I have tried just eliminating this one line from the accepted_hits.sam file - I still get the same error (perhaps from some later line.) I have also tried Cufflinks with output from different files coming from Tophat - I consistently get this same error. (Cufflinks does run fine with the test file supplied...)

Thanks for any help with this

HWI-EAS288_8_2_20_941_1818_0 0 gi|51511724|ref|NC_000008.9|NC_000008 111450969 255 64M * 0 0 ATAGCATCTTCCC
AGCTTCCATCTCCCTACAGTCCATCNTATTCAAGTCTTTAGCTATTTTGGA B@BBBB@BBBBABABA@@@A@@AA@??B;=7:=@?>A;%;>AB@?6?:?==?=@?@>?=@?>>8 NM:i:2
HWI-EAS288_8_2_117_405_131_0 0 gi|51511724|ref|NC_000008.9|NC_000008 111450982 255 42M * 0 0 AGCTTCCATCTCC
CTACAGTCCATCATATTCAAGTCTTTAGC <:A>9=,/8;297=;=;1208778=:2-2650'462-3586? NM:i:0
HWI-EAS288_8_1_9_672_1871_0 0 gi|51511724|ref|NC_000008.9|NC_000008 111530035 255 62M * 0 0 GGGAAACATGGTG
AAACCCTGTTTCTACTAAAAATACAAAAATTAGCCAGCTGTGGTGGCAA 6CCBBCCCCCB>BBBCCBAC@BCCCBBBCB@A>BCBBB@BACBAB<ABBB>B<>@??;%8@; NM:i:1
HWI-EAS288_8_2_79_444_2024_0 0 gi|51511724|ref|NC_000008.9|NC_000008 111637724 1 22M17834N536870911M * 0 0 GCAGCAACAGCGGCAGCGGCA ABAAAB@@@>AAABAB?ABAA NM:i:2 XS:A:+ NS:i:2
HWI-EAS288_8_2_79_444_2024_0 0 gi|51511724|ref|NC_000008.9|NC_000008 111637724 1 22M17840N536870911M * 0 0 GCAGCAACAGCGGCAGCGGCA ABAAAB@@@>AAABAB?ABAA NM:i:2 XS:A:+ NS:i:2
HWI-EAS288_8_2_79_444_2024_0 0 gi|51511724|ref|NC_000008.9|NC_000008 111637724 1 22M5744N536870911M * 0 0 GCAGCAACAGCGGCAGCGGCA ABAAAB@@@>AAABAB?ABAA NM:i:2 XS:A:+ NS:i:2
HWI-EAS288_8_2_56_390_1555_0 0 gi|51511724|ref|NC_000008.9|NC_000008 111643298 255 42M * 0 0 CAGCAAACCACCA
TGGCCCACATTTACCTATGTAACAAATCA BCBCCCCCCCBBCA;>C73-?CCBC@CBBBBCACBCCACBCC NM:i:1
HWI-EAS288_8_2_50_1601_1261_0 0 gi|51511724|ref|NC_000008.9|NC_000008 111809773 255 53M * 0 0 CTATTCTATACCA
TTCCATTCCATTCCATTCCATTCCATTCCATGCCATTCCA BCBBCCBAC:CCCCBBACCBCBBBBBB@BBBBBB?BAAB@BA6>ABBAAABB1 NM:i:2
HWI-EAS288_8_1_100_1688_1517_0 16 gi|51511724|ref|NC_000008.9|NC_000008 111829914 255 76M * 0 0 AGCCTTCAGTCTG
TGGCCAAAGGCCCAAGGGTCCCCAGCGAACCACTGGTGTAAGTCCAAGAGTCCGAAGGCTGAG =+,:9===?9;AAA>?B=??A=>9>?A>A?A@BAAABBAAA?ABABBBAABABBBABBBBBBBBBABBBBBBBBBB NM:i:
0
Daniel is offline   Reply With Quote
Old 08-18-2010, 03:30 AM   #2
Xi Wang
Senior Member
 
Location: MDC, Berlin, Germany

Join Date: Oct 2009
Posts: 317
Default

I think the CIGAR field in the 3 lines below caused the problem.

HWI-EAS288_8_2_79_444_2024_0 0 gi|51511724|ref|NC_000008.9|NC_000008 111637724 1 22M17834N536870911M * 0 0 GCAGCAACAGCGGCAGCGGCA ABAAAB@@@>AAABAB?ABAA NM:i:2 XS:A:+ NS:i:2
HWI-EAS288_8_2_79_444_2024_0 0 gi|51511724|ref|NC_000008.9|NC_000008 111637724 1 22M17840N536870911M * 0 0 GCAGCAACAGCGGCAGCGGCA ABAAAB@@@>AAABAB?ABAA NM:i:2 XS:A:+ NS:i:2
HWI-EAS288_8_2_79_444_2024_0 0 gi|51511724|ref|NC_000008.9|NC_000008 111637724 1 22M5744N536870911M * 0 0 GCAGCAACAGCGGCAGCGGCA ABAAAB@@@>AAABAB?ABAA NM:i:2 XS:A:+ NS:i:2
__________________
Xi Wang
Xi Wang is offline   Reply With Quote
Old 08-23-2010, 11:31 PM   #3
celeste8
Junior Member
 
Location: China

Join Date: Aug 2010
Posts: 2
Default

#!/usr/bin/perl

use warnings;
use strict;
while (<>) {
chomp;
my @parts = split /\t/;
if ( ( $parts[5]=~/(\d+)M\d+N(\d+)M/)&&($1>100)&&($2>100)) {
next;
}
else {
print "$_\n";
}
}

I have ever faced this problem. You can use this perl code to process your reads.
celeste8 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:48 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO