Hello everyone,
I am new to using NGS techniques and the bioinformatics tools for analysing the acquired data so I hope I can get some advice from more experienced users.
My objective: Assemble the draft genome of my sequenced individual by de novo assembly.
I carried out a single NextSeq500 run of one individual. It was a paired-end sequencing run (150 bp) and I ended up with 8 fastQ files (2 reads X 4 lanes).
Do I take the right approach if I just merge these fastQ files (using the ''cat'' tool)? Do the paired-reads stay ''intact'' so to say, which can be then used by the assembly tool?
After merging I will do a FastQC analysis on this merged file and will use cutadapt to remove adapter contamination and reads with low quality:
Cutadapt command
cutadapt \
- a GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGC \
-q 28 \
-m 20 \
Please let me know if you have any tips or advice a different approach.
I am new to using NGS techniques and the bioinformatics tools for analysing the acquired data so I hope I can get some advice from more experienced users.
My objective: Assemble the draft genome of my sequenced individual by de novo assembly.
I carried out a single NextSeq500 run of one individual. It was a paired-end sequencing run (150 bp) and I ended up with 8 fastQ files (2 reads X 4 lanes).
Do I take the right approach if I just merge these fastQ files (using the ''cat'' tool)? Do the paired-reads stay ''intact'' so to say, which can be then used by the assembly tool?
After merging I will do a FastQC analysis on this merged file and will use cutadapt to remove adapter contamination and reads with low quality:
Cutadapt command
cutadapt \
- a GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGC \
-q 28 \
-m 20 \
Please let me know if you have any tips or advice a different approach.
Comment