Hi all,
I've recently received some small RNA data and previously I used this sequence 'TCGTATGCCGTCTTCTGCTTG' to remove the 3' adaptors. However, it turns out a modified adaptor is now used ATCTCGTATGCCGTCTTCTGCTTG with Illumina 1.5 kit - notice the only difference is an additional 'ATC' at the 5' end.
The problem I'm seeing is that very many reads clearly have an adaptor sequence, but the first 1-5 bases are missing from the adaptor sequence so aren't being recognised by my 'detagging' script. I've not seen this before in other data we've had (which was a while back admittedly). Has anyone else seen this and is it a feature of the 1.5 kit?
Thanks for any pointers.
Cheers,
Chris
I've recently received some small RNA data and previously I used this sequence 'TCGTATGCCGTCTTCTGCTTG' to remove the 3' adaptors. However, it turns out a modified adaptor is now used ATCTCGTATGCCGTCTTCTGCTTG with Illumina 1.5 kit - notice the only difference is an additional 'ATC' at the 5' end.
The problem I'm seeing is that very many reads clearly have an adaptor sequence, but the first 1-5 bases are missing from the adaptor sequence so aren't being recognised by my 'detagging' script. I've not seen this before in other data we've had (which was a while back admittedly). Has anyone else seen this and is it a feature of the 1.5 kit?
Thanks for any pointers.
Cheers,
Chris