SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Xenome not outputting FASTQ formatted files? Seq^3 Bioinformatics 1 06-05-2014 02:35 PM
Tophat-fusion-post outputting no fusions spidermonkey Bioinformatics 3 08-08-2013 02:28 AM
Newbler outputting garbage drdna Bioinformatics 4 12-18-2012 06:23 AM
Problems with outputting GT information using samtools Rcucullatus Bioinformatics 0 09-26-2012 07:35 AM
BWA on raw sequences? history_of_robots Bioinformatics 3 03-12-2012 08:22 AM

Reply
 
Thread Tools
Old 11-09-2016, 08:51 AM   #1
tanyac123
Junior Member
 
Location: Montreal

Join Date: Nov 2016
Posts: 1
Default BWA not outputting sequences

Hi, I am having an issue with BWA genome alignment where sequence information is not being stored (i.e. sequence output in bam file is a * ). Can anyone tell me why this is happening and how to retrieve my sequences?? I need them for doing downstream SNP analysis. My code for alignment, sam to bam and sorting: bwa mem -t $cpu -r 1 -a -M -R $rg $genome $l | \ sambamba view -t $cpu -f bam -h -S /dev/stdin | \ sambamba sort -t $cpu -o $aligned/$flow/$lane/${nameNoExt}_RG_sorted.bam /dev/stdin

where $rg is my read group tag, $genome is the path to my genome file and $l is the loop to my input files

Here is a portion of the output when using: samtools view /path/to/file.bam | head -n 20 The first two have their sequences, while the remaining three output sequences have stars as their sequences. How can I tell bwa to keep these sequences?

HWI-ST521:68:C07EDACXX:2:2106:17357:162867 0 Gm01 30991 60 93M * 0 0 CAGCGTGAAGGGAACGAGTATTATTATTTATAACCAGCCACGTCATCAAGAGAAGAATATGGAAGGTGGATCGGGCCTTGCTATCCACACCCC FFFHFHHDHIIGJIJIJIEFGIJJJIIJJCIHGIGIIJJIJIGHGGFGIECHIIIIEHHHHEDFF<;@CACD>BBBBBC>ACDDCC>?><<@5 NM:i:1 MD:Z:45G47 AS:i:88 XS:i:0 RG:Z:PI438460 HWI-ST521:68:C07EDACXX:2:1103:2382:91229 0 Gm01 33652 60 49M * 0 0 CAGCAATTCTGATAACAGTACCATTTTTTTTTTTGGAAGGCAAAATTAG FFFHHHGHEGIBHIJIJJHIIGGIIJJJJJJJIGBHA?EC2?DECA;;; NM:i:0 MD:Z:49 AS:i:49 XS:i:26 RG:Z:PI438460 HWI-ST521:68:C07EDACXX:2:2106:5869:22021 256 Gm01 33999 0 60M34H * 0 0 * * NM:i:1 MD:Z:45T14 AS:i:55 RG:Z:PI438460 HWI-ST521:68:C07EDACXX:2:1101:3451:56376 256 Gm01 33999 0 59M35H * 0 0 * * NM:i:2 MD:Z:45T5A7 AS:i:49 RG:Z:PI438460 HWI-ST521:68:C07EDACXX:2:2106:19619:31878 256 Gm01 33999 0 59M35H * 0 0 * * NM:i:2 MD:Z:45T5A7 AS:i:49 RG:Z:PI438460
tanyac123 is offline   Reply With Quote
Old 11-09-2016, 01:54 PM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,059
Default

Potentially answered here: https://www.biostars.org/p/221323/
GenoMax is offline   Reply With Quote
Reply

Tags
bam files, bwa alignment, sequencing analysis

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:00 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO