
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
questions for cuffcompare and cuffdiff output liuxq Bioinformatics 0 01-04-2011 04:17 AM
questions for tophat liuxq Bioinformatics 0 09-14-2010 04:13 AM
Questions about TopHat yjlui Bioinformatics 0 07-29-2010 09:44 AM
TopHat questions Eugeni RNA Sequencing 12 11-29-2009 07:20 PM
TopHat questions statsteam Bioinformatics 1 11-10-2009 03:48 AM

Thread Tools
Old 02-21-2011, 01:32 AM   #1
Junior Member
Location: Cambridge

Join Date: Jun 2010
Posts: 5
Default Tophat output - Questions

I've been using Tophat to align 76bp paired-end data to the human genome.
I used samtools to convert the .BAM file to .SAM format and when looking at the aligned reads I came across the following questions.
  • I understand that for unstranded libraries (like mine) the use of XS tag for reads aligned over splice junctions is essential for Cufflinks. What I don't understand is why for some reads there are multiple alignments at the same position and their only difference is the XS tag. Look here for an example:

    IL28_5635:5:100:10006:3569 137 chr1 160325534 3 14M105N62M * 0 0 CAGACACTGCCAAGGCCCTGGCAGATGTGGCCACGGTGCTGGGACGTGCTCTGTATGAGCTTGCAGGAGGAACCAA %%%%%%%$%%%%%%%%%%%%%%%%%#%"%%%%%#%%!%$#%$$"#$"$#$""$""#"####$#####""""#"""# NM:i:0 XS:A:- NH:i:2 CC:Z:= CP:i:160325534
    IL28_5635:5:100:10006:3569 137 chr1 160325534 3 14M105N62M * 0 0 CAGACACTGCCAAGGCCCTGGCAGATGTGGCCACGGTGCTGGGACGTGCTCTGTATGAGCTTGCAGGAGGAACCAA %%%%%%%$%%%%%%%%%%%%%%%%%#%"%%%%%#%%!%$#%$$"#$"$#$""$""#"####$#####""""#"""# NM:i:0 XS:A:+ NH:i:2

    When I use the genomeCoverageBed function from BEDtools aren't these reads counted twice? Can this somehow be fixed?
  • Do people filter the Tophat output according to flags or MAPQ qualities?
    I would use the reads that are properly paired (flags:83, 99, 147, 163) or any singletons (flags:73, 89, 137, 153) but I don't understand the use of other flags (i.e. flags: 65, 81, 97, 113, 115, 129, 145, 161, 177, 179). What do they mean and should these be filtered out?
makost is offline   Reply With Quote
Old 02-21-2011, 09:41 AM   #2
Location: rishon le zion ,israel

Join Date: May 2010
Posts: 21

I join to your question: Do I need to filter these "bad" flags out, and to trust only the "samtools view -f 2"?
Thanks in advance
ozs2006 is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 10:23 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO