How to install Bowtie

[kaps]

Ok.

Have proceeded with the downstream tools hoping to visualize the results as below: samtools mpileup -u -f cowpea4RNAseq_ind.fa lib4seq.sorted.bam | bcftools view -cvg -> lib4seq.raw.bcf

but the response is as follows:

[fai_load] build FASTA index.
[fai_build_core] inlined empty line is not allowed in sequence 'gi|325930233|gb|JF427592.1|'.
[fai_load] fail to open FASTA index.
-bash: bcftools: command not found

Not sure where I am going wrong!

[GenoMax]

If you want to visualize the alignments then use Integrated Genomics Viewer: http://www.broadinstitute.org/igv/ You have to sort and index your BAM file (which you seem to have done). Cowpea genome is not going to be included IGV so you will need to supply a fasta (make a note) formatted file of the genome sequence to IGV. Use the same file you used for making the bowtie2 indexes.

As for the error above "bcftools" is a program from samtools package. It is included in the source and needs to be compiled (if your administrators have not done so ask them to do that). Only required if you are going to do SNP calling.

[kaps]

Any additional clues on how to run igv (igv or igvtools?)?

[GenoMax]

Are you having trouble using IGV? If you are running it from the server you will need to use X11/X-Windows. http://www.broadinstitute.org/igv/UserGuide

BTW: Start creating a new thread when you have new questions. The current questions are no longer related to the parent thread.

[kaps]

Originally Posted by GenoMax

Use the server for all your work. With just 2G of RAM the local computer should only be used to access the server.

I am going to point you to a guide about how to use bowtie2: http://homer.salk.edu/homer/basicTutorial/mapping.html.

You will need a multi-fasta formatted file for your virus sequences (blast db files are not usable).

Broad steps:

1. Create an index for your virus sequences (bowtie2-build). This is what you are going to search against.

$ /path_to/bowtie2-build virus.fa VIR

VIR would become the "basename" for the bowtie2 index.

2. Start with trimmed/qc'ed fastq data.
3. Do the alignments (bowtie2) and save results in sam format file.

Single-end reads

$ /path_to/bowtie2 -p 2 -x VIR -U sample1_file.fastq -S sample1.sam

Paired-end reads

$ /path_to/bowtie2 -p 2 -x VIR -1 sample1_R1_file.fastq -2 sample1_R2_file.fastq -S sample1.sam

-p 2 is number of cores used for search. Keep to <= 4 for now. Provide "basename" (VIR) for index for -x option. Do not include file extensions.

4. Use samtools to "view/sort/index" sam file to bam format.
5. Evaluate the bam file.

Hello,
Why would bowtie abort with such a command?

bowtie2 -p 2 -x CABFG -U clc_trim_pair4.fq -S S4_clc_trm.sam
Error: Read No_name has more quality values than read characters.
terminate called after throwing an instance of 'int'
(ERR): bowtie2-align died with signal 6 (ABRT)

[GenoMax]

Post a few lines from clc_trim_pair4.fq. Are you getting that error right away?

$ head -6 clc_trim_pair4.fq

[kaps]

Originally Posted by GenoMax

Post a few lines from clc_trim_pair4.fq. Are you getting that error right away?

$ head -6 clc_trim_pair4.fq

This is what I get:
@No_name
CAACATTACCTAGTGCAAGACAGTGTTAATTTGAAGGCAGTTCATA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@No_name
TTTTTTTTTTTTTTTTCTTTTCTCAACTTCCTTCACCTTCACACTCTCTTTCCCTTCTTC

[GenoMax]

Is that all the sequence in the file? Just one record?

If not, are all sequences called "NO_name"? That is not going to work since the names are not unique.

Post output of.

$ ls -lh clc_trim_pair4.fq

[sandia]

Hi all,
I've been trying to download Bowtie2.2.5 for Mac and followed instructions on this forum. The consistent error message I've been getting is: (ERR): Expected bowtie2 to be in same directory with bowtie2-align: /Applications/bowtie2-2.2.5/
I've followed suggestions from others with this problem to address this and I've realized that bowtie2-align is not in the folder I am downloading. Is this normal? Do I need to retrieve it elsewhere? I assume I am missing something basic since I am new to all this. Thanks in advance for any help.

[GenoMax]

bowtie2 web site appears to be experiencing issues at the moment (can't get to the 2.2.6 code). Are you downloading the pre-compiled binary zip file for OS X from this link: http://sourceforge.net/projects/bowt...owtie2/2.2.5/? After uncompressing the archive all files you need should be in the uncompressed folder.

[sandia]

Thanks for the reply. Yes I've downloaded that file but it does not contain bowtie2-align.

[GenoMax]

I just checked the zip archive and the executables are all there (there are multiple align versions, bowtie2-align-l,bowtie2-align-s etc). You should run bowtie2 like so

$ bowtie2 -help

[sandia]

Got it, thank you!