cutadapt questions on pair-end seqeuencing data

bbm · 10-07-2015, 03:36 PM

I'm trying to use cutadapt to trim my data. The adaptor sequences from Illumina only has a universal adapter, then one sequence for each index.
Example here:
TruSeq Universal Adapter
5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
TruSeq Adapter, Index 1 5
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 2
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 3
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG

When I read the guide from cutadapt for pair-end data, they suggest a file named ADAPTER_FWD (should be trimmed from the forward reads (filename.1.fastq.gz) and a file named ADAPTER_REV from the reverse reads (filename.2.fastq.gz).
So my question is: What sequence do I put in ADAPTER_FWD, and what sequence in ADAPTER_REV?

The command is:
cutadapt -a ADAPTER_FWD -A ADAPTER_REV -o out.1.fastq -p out.2.fastq reads.1.fastq reads.2.fastq

bbm · 10-07-2015, 03:58 PM

Another related question here:
My sequencing center said they didn't trimmed any adapters. So I went to the fastq.gz files, and grep the adapter sequence for the first 1 million reads, I only have 10442 hits. I wonder why the hits number is so small? Does that mean 989,558 reads are shorter and without the adapters?
Thanks!

Brian Bushnell · 10-07-2015, 04:20 PM

Most sequences will be shorter than full length, and/or contain errors, and thus not match exactly with grep.

I recommend you use BBDuk for adapter trimming, using the command at the top of the post.

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
comparison of Ion Proton RNAseq data with Illumina pair end data?	vipul jain	General	3	01-25-2015 12:11 PM
MiSeq FastQ Header for pair-end data	golharam	Illumina/Solexa	3	01-16-2015 03:06 PM
75+35 Pair-end SOLiD RNA-seq data analysis	endether	SOLiD	11	12-12-2012 05:40 PM
how to combine pair end data into one file	forget1997	Bioinformatics	6	06-19-2011 02:45 PM
What is this strand specific pair-end RNA-seq data?	xhuister	Bioinformatics	2	09-14-2010 07:34 AM

10-07-2015, 03:36 PM	#1
bbm Member Location: North Carolina Join Date: Sep 2011 Posts: 38	cutadapt questions on pair-end seqeuencing data I'm trying to use cutadapt to trim my data. The adaptor sequences from Illumina only has a universal adapter, then one sequence for each index. Example here: TruSeq Universal Adapter 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT TruSeq Adapter, Index 1 5 5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 2 5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 3 5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG When I read the guide from cutadapt for pair-end data, they suggest a file named ADAPTER_FWD (should be trimmed from the forward reads (filename.1.fastq.gz) and a file named ADAPTER_REV from the reverse reads (filename.2.fastq.gz). So my question is: What sequence do I put in ADAPTER_FWD, and what sequence in ADAPTER_REV? The command is: cutadapt -a ADAPTER_FWD -A ADAPTER_REV -o out.1.fastq -p out.2.fastq reads.1.fastq reads.2.fastq

10-07-2015, 03:58 PM	#2
bbm Member Location: North Carolina Join Date: Sep 2011 Posts: 38	Another related question here: My sequencing center said they didn't trimmed any adapters. So I went to the fastq.gz files, and grep the adapter sequence for the first 1 million reads, I only have 10442 hits. I wonder why the hits number is so small? Does that mean 989,558 reads are shorter and without the adapters? Thanks!

10-07-2015, 04:20 PM	#3
Brian Bushnell Super Moderator Location: Walnut Creek, CA Join Date: Jan 2014 Posts: 2,707	Most sequences will be shorter than full length, and/or contain errors, and thus not match exactly with grep. I recommend you use BBDuk for adapter trimming, using the command at the top of the post.