demultiplexing and splitting MiSeq data

[SeqTrbl]

I got the following files from a service provider while doing MiSeq sequencing. Can someone help me in demultiplexing and splitting this files? I have used 24 independent indexes for indexing.

Read1:

@130110_A5T23:1:1101:15646:1320:1#0/1
NAGTAAGATACAGTCTATCGGGTTTAAGTTATACAACATAGTACAGTACATTCATACCTACCTCTGCAATTAAATTTGGCGGTGTCATAATGTCTTTCAGCACAACTAAAAGAAAAGTTTAAAAGTGATATAAAGTTATCTTTTGCACTT
+
#>>AABFFFFFFGGGGGGGGGGCFGHHHHHHHHHHHHHHHHGFHHHHHHHHGHGHHHHHHGHHGHHHGHHHHHHHHHEHGGGEEFGHHHHFHHHGHHHHFHHHHGGGHHHHGGHHGHHHHHHHGHBGHHHHHHHHHFHFHHHHHGHFHHH
@130110_A5T23:1:1101:17282:1320:0#0/1
NGGGAGGATGGCTTGAGCCTAGAGGGTTGAGGCTGCAGTGAGCTGTGAGCATGCCATTGCACTCCAGCCTGGGCAACAGAGTGAGGCTCTGTCTCAAAAAAAAAAAAAAAAAAAAAAGAAATAAAATATAAGGGACATAAAATAAAGCAA
+
#>>AAA1A1B>F1A1FAFGCG0GBFEAAEHGBFCFFHHA1FEGGFFGGFFHHHGHHHHGHHHHHHHHHGHGGGHHGHHHFHGHGFGGHHHHHHHHHFGHHGGGEGGGGGGGGGGGCC.<<G0DGGFC:CCC0CC.::00:<00:9C####

Index

@130110_A5T23:1:1101:15646:1320:1#0/2
NTTGTATC
+
#>>AAAFF
@130110_A5T23:1:1101:17282:1320:0#0/2
NTTAGTCT
+
#1>>AAFF

[mikep]

Short of writing a custom script that does this, you'll probably need the MiSeq reporter software, and you might need the original raw data as well.

http://support.illumina.com/sequencing/sequencing_software/miseq_reporter.ilmn

I say "might" because I haven't used it myself, although I did have a MiSeq run that failed to demultiplex recently, so I will be going the custom script route myself.

[SeqTrbl]

Hi MikeP

Thanks for your reply. But my problem is that I dont have the raw file and I am not a bioinformatican. Thats why I am hoping that some forum member will help me in resolving this issue.

Thanks and regards

[mikep]

1) Are there as many lines in the index file as there are in the read 1 file
2) Are the accession numbers in the same order in each file
3) Does any part of the sequence in the index file match your indexes
4) How many mismatches in the index are allowed

[SeqTrbl]

Hi MikeP
Plz find the point to point reply bellow

1. yup there are same number of line in Read1 fastq as well as index fastq.

2. Sequence identifiers are same for both index and read1 sequences except the last character. In case of Read1 its /1 and in case of index its /2.

3. Yah the sequences of the index files are the different indexes i used for multiplexing my samples.

4. I have not dont this yet; but I will prefer to allow maximum 1 mismatch. Actually the sequence files were provided by sequencing service provider long back and i joinef lab letter. So i cant get the raw files now.

[mikep]

What I can do is give you a script that will restitch the barcode back onto the 5' end of the sequence. You could then use fastx barcode splitter to demultiplex

http://hannonlab.cshl.edu/fastx_toolkit/commandline.html#fastx_barcode_splitter_usage

[SeqTrbl]

Hi MikeP

Thanks. That will be great help.

[mikep]

alright, quick and dirty, but should work. This is a python script. Rename it to stitch.py

**Disclaimer**
Any use of this script comes at users risk and it is not guaranteed to do anything useful.