![]() |
|
![]() |
||||
Thread | Thread Starter | Forum | Replies | Last Post |
FastX-toolkit | liu_xt005 | Bioinformatics | 13 | 10-11-2014 05:52 AM |
FASTX-Toolkit: quality score value | thinkRNA | Bioinformatics | 13 | 09-30-2014 10:25 AM |
Has anyone used FastX Toolkit with IonTorrent data? | gkijak | Ion Torrent | 7 | 06-05-2013 06:16 PM |
Filtering Illumina GAIIx reads using fastx | rubi | Bioinformatics | 8 | 05-02-2011 04:54 AM |
matching unmapped paired SOLiD reads | smarkel | General | 6 | 10-09-2009 12:49 PM |
![]() |
|
Thread Tools |
![]() |
#41 | ||
Junior Member
Location: SP, Brazil Join Date: Apr 2014
Posts: 4
|
![]() Quote:
Quote:
...................................................................................................................................Ok, I didn't try using Pairfq, but I will. Thank you for the answer! |
||
![]() |
![]() |
![]() |
#42 | |
Junior Member
Location: SP, Brazil Join Date: Apr 2014
Posts: 4
|
![]() Quote:
Pairfq worked pretty well!! Thank you! |
|
![]() |
![]() |
![]() |
#43 |
Junior Member
Location: Delhi Join Date: May 2014
Posts: 2
|
![]()
After removing the adapters from cutadapt i got unsymmetrical pair end file so I want to know the script that could remove the orphan reads and make the data symmetric although I made it using hash but its very slow.The above mention script is showing error..
|
![]() |
![]() |
![]() |
#44 | |
Senior Member
Location: Vancouver, BC Join Date: Mar 2010
Posts: 275
|
![]() Quote:
Also, what do you mean when you say the script is showing error? It is not possible to know what the issue is based on that information alone. |
|
![]() |
![]() |
![]() |
#45 |
Super Moderator
Location: Walnut Creek, CA Join Date: Jan 2014
Posts: 2,707
|
![]()
BBTools has a tool to quickly re-pair arbitrarily disordered reads based on their names.
For interleaved reads: repair.sh in=reads.fq out=fixed.fq outsingle=single.fq For paired reads in two files: repair.sh in1=read1.fq in2=read2.fq out1=fixed1.fq out2=fixed2.fq outsingle=single.fq You can also repair simple broken interleaving much faster and with less memory, but this will not fix arbitrarily disordered reads, just reads that were interleaved and had some of the reads thrown away: bbsplitpairs.sh in=reads.fq out=fixed.fq outsingle=single.fq fixinterleaving Last edited by Brian Bushnell; 02-13-2015 at 10:31 AM. |
![]() |
![]() |
![]() |
#46 | |
Senior Member
Location: Vancouver, BC Join Date: Mar 2010
Posts: 275
|
![]() Quote:
For reference, I was simply trying to compare this to Pairfq (a tool for pairing reads, which was mentioned above), since I am the author of that tool. |
|
![]() |
![]() |
![]() |
#47 |
Super Moderator
Location: Walnut Creek, CA Join Date: Jan 2014
Posts: 2,707
|
![]()
SES,
Thanks for reporting that! I'll have a fixed version of the shellscript up later today. If you want to test it in the meantime, you can replace repair.sh with java -ea -Xmx8g -cp /path/to/bbmap/current/ jgi.SplitPairsAndSingles ...where "-Xmx8g" can be adjusted to be around 80% of your node's physical memory. For a menu, "repair.sh" or "repair.sh -h" will still work and they should not run ulimit. But I'm a bit confused about your comment on calculating files in mounted file systems. My cluster is attached to several multi-petabyte file systems containing hundreds of millions of files, a couple of which are very slow, and "ulimit -v" always returns an answer instantly even if "ls" takes several seconds to respond. |
![]() |
![]() |
![]() |
#48 | |
Senior Member
Location: Vancouver, BC Join Date: Mar 2010
Posts: 275
|
![]() Quote:
|
|
![]() |
![]() |
![]() |
#49 |
Super Moderator
Location: Walnut Creek, CA Join Date: Jan 2014
Posts: 2,707
|
![]()
SES,
I uploaded v32.27 which fixes the bug you found in repair.sh. I'd be interested in knowing whether it still prints directory information on your system. -Brian |
![]() |
![]() |
![]() |
#50 |
Junior Member
Location: USA Join Date: Oct 2014
Posts: 2
|
![]()
Hi! I am having issue in using pairfq. Probably, it does not identify Illumina 1.9 fastq format and gives me following error.
ERROR: Could not determine FASTA/Q format. Please see https://github.com/sestaton/Pairfq or the README for supported formats. Exiting. could you please update it to solve this problem? If someone has and can share tool and/or script to sort and separate paired-end common and unique reads. My reads and header identifiers look like this Read1.fastq @6_1101_1236_2393_1 AATTCATAAAAAACAACTGAATTGGATCACTGTAGTACAAATTGCAAACATTCACTATGGGCAAACAAGNNNNNNNNNNNNNNNNNNNNNNNNNN + FDDHHHHFJJJIIJJIIIJGHHIJJEHHJJIJHIGIJJJJJHIIIJJJIJIJGIIJJJJIJHIIJJGHH########################## @6_1101_1728_2439_1 AATTCATCGGGAACGACCTGTTGCCTTTTCAAATCTTTCTAAGTTATTCTGTTCAGCTGCAAAGACTTGACATATTTNNNNNNNNNNNNNNNNNN + FFFHHGHHJJJGIJJJJJJJJJJJJJJJFGGIJJIIIIJJJIJIIGJJJJJJJJJJIIJJJFJGFHDHHFFFFCEEE################## Read2.fastq @6_2316_20850_100973_2 AATAAAATCAATCCAGACTAGCGGCACATTTTGACTGTTAAGTTTGAACTTCCTAAAATCTGTGCAGGCTTTTAAGCTGTACTGTTTTTCTT + HFHHHIJJIJJIJJIDHIJJFHIBHGJIBHIJICHIIJJ>CBFBFH=CFIIIJI).@DHHGEEEHDFBFECEEC@>@CDCCDBCBCDDDDDD @6_2316_21147_100977_2 GCTGTTTTTAAATTTAAAATTTAAAAAGTGCTTTTTGTTGTTGTTTTTTTAAAAGGAAAAGGCTTCCTATAACTTCTCATGCTGGACAACAC + HHHHHJJJJEGHJIJJJJJJJJIIHHIJHGHIJJJJJIJJJJGHIIJJJJJJEH=AHFF>DFDEDEEDDD>CDDEDDDDAACDCCBDAAABD Thanks |
![]() |
![]() |
![]() |
#51 |
Senior Member
Location: Vancouver, BC Join Date: Mar 2010
Posts: 275
|
![]()
The expected pair information is missing from these reads, at least I have not seen data of this format. The solution is to add the pair information and then pair the reads.
Code:
pairfq addinfo -i Read1.fastq -o Read1_pairinfo.fastq -p 1 pairfq addinfo -i Read2.fastq -o Read2_pairinfo.fastq -p 2 Code:
pairfq makepairs -f Read1_pairinfo.fastq \ -r Read2_pairinfo.fastq \ -fp Read1_p.fastq \ -rp Read2_p.fastq \ -fs Read1_s.fastq \ -rs Read2_s.fastq \ --stats Last edited by SES; 01-05-2015 at 11:13 AM. Reason: fix typo |
![]() |
![]() |
![]() |
#52 |
Junior Member
Location: USA Join Date: Oct 2014
Posts: 2
|
![]()
Thanks for this, yes these IDs are not generated by any sequencing platform. These come out of Stacks pipeline when you use demultiplexing and quality filtering of RAD data. It will be good to consider this in the script which will widen the usage of program straight away for many other people like me.
Actually, I got another different issue. I started using a Linux machine from a different lab and I tried to submit script using qsub command and it says -bash: qsub: command not found when I write which qsub I get following /usr/bin/which: no qsub in (/usr/lib64/qt-3.3/bin:/usr/local/bin:/bin:/usr/bin:/usr/local/sbin:/usr/sbin:/sbin:/home/user/bin) When I tried man qsub it opens qsub help and instruction. I don't understand why I am not able to submit my shell script I am trying to use following codes for submission qsub -q all.q -cwd test.sh I will appreciate any help or guidance in this regard. Thanks, |
![]() |
![]() |
![]() |
#53 | ||
Senior Member
Location: Vancouver, BC Join Date: Mar 2010
Posts: 275
|
![]() Quote:
Quote:
|
||
![]() |
![]() |
![]() |
#54 |
Super Moderator
Location: Walnut Creek, CA Join Date: Jan 2014
Posts: 2,707
|
![]()
qsub is just for clusters using UGE/SGE (as far as I know). If you are trying to operate on a cluster with a different scheduler, you would need a different command; but if you just want to run in Linux without submitting a job to a scheduler, then your command in this case would simply be "sh test.sh".
|
![]() |
![]() |
![]() |
#55 |
Junior Member
Location: Austria Join Date: Sep 2014
Posts: 4
|
![]()
Since this has generally remained a common problem, I wrote a Perl script that removes the unpaired reads and matches the paired ones. Just generate a Perl file by copying and pasting the code below into a .pl file and run it. I hope, it will help as it helped me :-)
Code:
#!/usr/bin/perl use strict; use warnings; use File::Basename; ######################## sub suffix_remover($); ################ ########################### ############################ ########################### =cut Should you decide to make this script publicly available, copy the suffix_remover() subroutine into here. This script takes as input two fastq files with the forward and reverse unmatched mates for a paired-end read data set. Input: provide on the command line, the paired-end read files (forward and reverse) containing reads that need to be matched. Output: the forward and reverse mate files will be matched and written to READNAME_sorted.fastq, where 'READNAME' is simply the name of the file provided. The READNAME_singletons.fastq files contain the singleton reads (reads with no matching mates) for both the input files. by: Armin PEYMANN =cut ################ ########################### ############################ ########################### sub sequence_separator ($); sub hash_maker_using_fastq_sequences (\@); ############################################ my $path_read1 = shift @ARGV; my $path_read2 = shift @ARGV; my $qx_output_read1 = qx(wc -l $path_read1); my ($number_of_lines_read1) = split(/\s/, $qx_output_read1); my $qx_output_read2 = qx(wc -l $path_read2); my ($number_of_lines_read2) = split(/\s/, $qx_output_read2); if ($number_of_lines_read1 % 4 != 0 || $number_of_lines_read2 % 4 != 0){ die "The number of lines in one of the files is not dividable by 4.\nFor each sequence in your fastq files, you must have" . " the following lines:\n" . "\@HEADER\nSEQUENCE\n+QUALITY-HEADER\nQUALITY VALUES\n" . "Also make sure there is no empty line at the end of your file.\n"; } my @read1 = @{sequence_separator($path_read1)}; my %read1 = %{hash_maker_using_fastq_sequences(@read1)}; undef @read1; my @read2 = @{sequence_separator($path_read2)}; my %read2 = %{hash_maker_using_fastq_sequences(@read2)}; undef @read2; my $dir_read1 = dirname($path_read1); my $read1_name_without_suffix = suffix_remover($path_read1); my $path_out_read1 = $dir_read1 . "/" . $read1_name_without_suffix . "_sorted.fastq"; open(FH_OUT1, ">$path_out_read1"); my $dir_read2 = dirname($path_read2); my $read2_name_without_suffix = suffix_remover($path_read2); my $path_out_read2 = $dir_read2 . "/" . $read2_name_without_suffix . "_sorted.fastq"; open(FH_OUT2, ">$path_out_read2"); my $path_out_read1_singletons = $dir_read1 . "/" . $read1_name_without_suffix . "_singletons.fastq"; open(FH_OUT3, ">$path_out_read1_singletons"); foreach my $key (sort keys %read1){ if (exists $read2{$key}){ print FH_OUT1 $read1{$key}; print FH_OUT2 $read2{$key}; }else{ print FH_OUT3 $read1{$key}; } } close FH_OUT1; close FH_OUT2; close FH_OUT3; print "sorted reads were written to:\n"; print "Check out $path_out_read1" . "\n"; print "Check out $path_out_read2". "\n" . "\n"; my $path_out_read2_singletons = $dir_read2 . "/" . $read2_name_without_suffix . "_singletons.fastq"; open(FH_OUT4, ">$path_out_read2_singletons"); foreach my $key (sort keys %read2){ unless (exists $read1{$key}){ print FH_OUT4 $read2{$key}; } } close FH_OUT4; print "single reads with no mate were written to:\n"; print "Check out $path_out_read1_singletons" . "\n"; print "Check out $path_out_read2_singletons" . "\n"; sub hash_maker_using_fastq_sequences (\@){ my $array_ref = shift; my @read = @{$array_ref}; my %read; foreach my $sequence (@read){ my $copy_sequence = $sequence; my ($first_header) = split(/\n|\r/, $copy_sequence); $first_header =~ /(.+)[# ]/; # one single space or '#' should cover most of fastq files. my $pair_id = $1; $read{$pair_id} = $sequence; } return \%read; } sub sequence_separator ($){ my $path_read = shift; my $line_counter = 0; my $event; my @events; open(FH_IN, $path_read) or die "unable to open FH_IN1\n"; while(my $line = <FH_IN>){ $line_counter++; if ($line_counter <= 4){ $event .= $line; } if ($line_counter == 4){ push(@events, $event); undef $event; $line_counter = 0 } } close FH_IN; return \@events; } sub suffix_remover($){ #get rid of the .<format> in the file name. (If there are more my $pathOfDesiredFile = shift; #than one dot in the file name, the shortest part of the file name will be taken!) $pathOfDesiredFile =~ /([^\/]+)(?!\/)$/; my $desiredFileName = $1 if $1; $desiredFileName =~ s/(\..+)(?!\.)// if $desiredFileName =~ /\./ ; return $desiredFileName; } Last edited by Brian Bushnell; 07-30-2015 at 09:52 AM. Reason: Wrapped in [code] |
![]() |
![]() |
![]() |
#56 |
Senior Member
Location: Vancouver, BC Join Date: Mar 2010
Posts: 275
|
![]()
On the contrary, I think this is a solved problem for the most part. There are at least two general solutions (Pairfq and bbtools) discussed above that work on multi-line fasta/q, compresed files, and handle different Illumina variants. The Pairfq option doesn't require any install. It might seem like this is a common issue, but in my opinion, that is because people find this thread and try the Python script posted early on and they keep running into the same issues. It appears that script is not maintained so no one can get it to work.
There's no harm in rolling your own solution, but people should know (if they haven't followed the whole discussion) that there are working (and tested, documented) solutions. |
![]() |
![]() |
![]() |
#57 |
Junior Member
Location: Hong Kong Join Date: Aug 2020
Posts: 1
|
![]()
How to download this script?
Last edited by jessieHOU; 08-21-2020 at 05:09 AM. |
![]() |
![]() |
![]() |
#58 |
Senior Member
Location: East Coast USA Join Date: Feb 2008
Posts: 7,091
|
![]()
Download BBMap suite. "repair.sh" is the program that will sync paired-end data files. It is part of BBtools ahd has a guide available.
|
![]() |
![]() |
![]() |
Tags |
fastx-toolkit, paired-end reads |
Thread Tools | |
|
|