how to extract unique hits from a sam file

gfmgfm · 01-01-2011, 11:33 AM

I aligned reads with bwa and I want to get a set of the reads that mapped uniquely to the genome.
I understood from samtools faq that they suggest to look at 'reliable' rather than `unique' by :

samtools view -bq 1 aln.bam > aln-reliable.bam

http://sourceforge.net/apps/mediawik...?title=SAM_FAQ

However, I am interested to get the subset of the uniquely mapped reads, in order to do some calculations on it.

How can one do it?

drio · 01-02-2011, 05:39 AM

Take a look to this thread.

I'd suggest you follow bwa's FAQ advice and rely more in the MAPQ. Still, if you want to
filter uniquely mapped:

Code:

$ samtools view bwa.bam | grep "XT:A:U"

gfmgfm · 01-02-2011, 11:13 AM

Thanks a lot!

seq_GA · 01-23-2011, 09:34 PM

Hi,
I am also looking for such solution. But in my bam file, I don't see any

Code:

XT:A:U

instead its a SOLEXA single read where I have converted export to sam format as below.

Code:

test_1:8:69:19633:9434       0       chr10   5423197 4       45M     *       0       0       CACACAACCCCCACACCAAACACACACCCCCCACACACAACAAAC      0.2B90+)*=@8@################################   XD:Z:6C11C15G4CACT2     SM:i:4
test_1:8:56:11474:20981      0       chr10   7323903 6       45M     *       0       0       ATCAAGCGATCCTCCCACCTCATCCCCCTAAGTACCTGTGACTAA      757@54;3;1@@@@@22@###########################   XD:Z:22G11G3G5C SM:i:6

Any generic way of picking unique hits from sam file? Thanks.

gfmgfm · 01-23-2011, 10:48 PM

I am not an expert, but don't think you can extract this from the _export file. I think XT:A:U is specific to bwa (maybe also other aligners?).

Maybe you would like to use the _sorted file from the Illumina pipeline:
the desciption of the _sorted file- from CASAVA 1.7 manual p. 73:
This output file is similar to s_N_export.txt, except it contains
only entries for reads which pass purity filtering and have a
unique alignment in the reference. These are sorted by order
of their alignment position, which is meant to facilitate the
extraction of ranges of reads for purposes of visualization or
SNP calling.
These files are only produced if the flag WITH_SORTED is
used."

Alternatively, you can take your reads and align them with bwa (or with other aligner that gives you this info).

emp · 01-25-2014, 04:55 AM

hello all,
I have Illumina data, which I mapped through Bowtie2 and got a sam file.

Now I need to extract the reads which are being shown uniquely one time.

Kindly guide if something could be done for that.

I have tried a bit of commands for the above, but failed to get those reads separated.

Kindly guide ASAP.

Wallysb01 · 01-25-2014, 07:06 PM

Quote:

Originally Posted by emp

hello all,
I have Illumina data, which I mapped through Bowtie2 and got a sam file.

Now I need to extract the reads which are being shown uniquely one time.

Kindly guide if something could be done for that.

I have tried a bit of commands for the above, but failed to get those reads separated.

Kindly guide ASAP.

How about just use bowtie with the -m 1 option set?

emp · 01-26-2014, 11:13 PM

hello Wallysb01,

after searching a lot for Bowtie2 to get uniquely matched reads, I think bowtie 1 is the only way out.

thanku for the same.

dpryan · 01-27-2014, 01:49 AM

Unique alignments in bowtie2 have MAPQ>=2, so you can just filter the results by that.

brojee · 07-07-2019, 08:24 AM

Possibly you might want to utilize the _sorted document from the Illumina pipeline:

the desciption of the _sorted document from CASAVA 1.7 manual p. 73:

This yield document is like s_N_export.txt, with the exception of it contains

entries for peruses which pass immaculateness separating and have a

special arrangement in the reference. These are arranged by request

of their arrangement position, which is intended to encourage the

extraction of scopes of peruses for motivations behind representation or

SNP calling.

These documents are possibly created if the banner WITH_SORTED is

utilized."

On the other hand, you can take your peruses and adjust them to bwa (or with other aligner that gives you this data).

brojee · 07-07-2019, 08:33 AM

Possibly you might want to utilize the _sorted document from the Illumina pipeline:

the desciption of the _sorted document from CASAVA 1.7 manual p. 73:

This yield document is like s_N_export.txt, with the exception of it contains

entries for peruses which pass immaculateness separating and have a

special arrangement in the reference. These are arranged by request

of their arrangement position, which is intended to encourage the

extraction of scopes of peruses for motivations behind representation or

SNP calling.

These documents are possibly created if the banner WITH_SORTED is

utilized."

On the other hand, you can take your peruses and adjust them to bwa (or with other aligner that gives you this data).

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
extract full fasta file for local blast hits	Oyster	Bioinformatics	9	07-07-2019 08:39 AM
extract alignment from SAM with a GFF file	NicoBxl	Bioinformatics	4	08-02-2011 02:45 PM
Extract perfectly mapped reads from SAM/BAM file	Graham Etherington	Bioinformatics	2	07-21-2011 08:27 AM
Filtering multi hits from sam file	David Lyon	Bioinformatics	1	05-27-2010 12:18 PM
hits information in sam file	totalnew	Bioinformatics	0	08-06-2009 02:15 PM

01-01-2011, 11:33 AM	#1
gfmgfm Member Location: il Join Date: Jun 2010 Posts: 64	how to extract unique hits from a sam file I aligned reads with bwa and I want to get a set of the reads that mapped uniquely to the genome. I understood from samtools faq that they suggest to look at 'reliable' rather than `unique' by : samtools view -bq 1 aln.bam > aln-reliable.bam http://sourceforge.net/apps/mediawik...?title=SAM_FAQ However, I am interested to get the subset of the uniquely mapped reads, in order to do some calculations on it. How can one do it?

01-02-2011, 05:39 AM	#2
drio Senior Member Location: 41°17'49"N / 2°4'42"E Join Date: Oct 2008 Posts: 323	Take a look to this thread. I'd suggest you follow bwa's FAQ advice and rely more in the MAPQ. Still, if you want to filter uniquely mapped: Code: $ samtools view bwa.bam \| grep "XT:A:U" __________________ -drd

07-07-2019, 08:24 AM	#10
brojee Member Location: Bhopal Join Date: Jul 2019 Posts: 19	Possibly you might want to utilize the _sorted document from the Illumina pipeline: the desciption of the _sorted document from CASAVA 1.7 manual p. 73: This yield document is like s_N_export.txt, with the exception of it contains entries for peruses which pass immaculateness separating and have a special arrangement in the reference. These are arranged by request of their arrangement position, which is intended to encourage the extraction of scopes of peruses for motivations behind representation or SNP calling. These documents are possibly created if the banner WITH_SORTED is utilized." On the other hand, you can take your peruses and adjust them to bwa (or with other aligner that gives you this data). __________________ Best SEO Company in Bhopal, Best Web Development Company in Bhopal

07-07-2019, 08:33 AM	#11
brojee Member Location: Bhopal Join Date: Jul 2019 Posts: 19	Possibly you might want to utilize the _sorted document from the Illumina pipeline: the desciption of the _sorted document from CASAVA 1.7 manual p. 73: This yield document is like s_N_export.txt, with the exception of it contains entries for peruses which pass immaculateness separating and have a special arrangement in the reference. These are arranged by request of their arrangement position, which is intended to encourage the extraction of scopes of peruses for motivations behind representation or SNP calling. These documents are possibly created if the banner WITH_SORTED is utilized." On the other hand, you can take your peruses and adjust them to bwa (or with other aligner that gives you this data). __________________ Best SEO Company in Bhopal, Best Web Development Company in Bhopal

01-02-2011, 11:13 AM	#3
gfmgfm Member Location: il Join Date: Jun 2010 Posts: 64	Thanks a lot!

01-23-2011, 10:48 PM	#5
gfmgfm Member Location: il Join Date: Jun 2010 Posts: 64	I am not an expert, but don't think you can extract this from the _export file. I think XT:A:U is specific to bwa (maybe also other aligners?). Maybe you would like to use the _sorted file from the Illumina pipeline: the desciption of the _sorted file- from CASAVA 1.7 manual p. 73: This output file is similar to s_N_export.txt, except it contains only entries for reads which pass purity filtering and have a unique alignment in the reference. These are sorted by order of their alignment position, which is meant to facilitate the extraction of ranges of reads for purposes of visualization or SNP calling. These files are only produced if the flag WITH_SORTED is used." Alternatively, you can take your reads and align them with bwa (or with other aligner that gives you this info).

01-25-2014, 04:55 AM	#6
emp Member Location: india Join Date: Jan 2014 Posts: 11	hello all, I have Illumina data, which I mapped through Bowtie2 and got a sam file. Now I need to extract the reads which are being shown uniquely one time. Kindly guide if something could be done for that. I have tried a bit of commands for the above, but failed to get those reads separated. Kindly guide ASAP.

01-26-2014, 11:13 PM	#8
emp Member Location: india Join Date: Jan 2014 Posts: 11	hello Wallysb01, after searching a lot for Bowtie2 to get uniquely matched reads, I think bowtie 1 is the only way out. thanku for the same.

01-27-2014, 01:49 AM	#9
dpryan Devon Ryan Location: Freiburg, Germany Join Date: Jul 2011 Posts: 3,480	Unique alignments in bowtie2 have MAPQ>=2, so you can just filter the results by that.