i5 / i7 dual indexing + ATAC

ETBA · 08-24-2020, 05:57 AM

Hello,

I am constructing an ATAC-seq library using the standard Illumina kit (Nextera DNA Flex Library Prep, FC-121-1030). A previous user suggested dual indexing to minimise index hopping which I am grateful for. We have access to a Hiseq X-Ten (paired-end 100bp) and illumina suggests to use the reverse complement of the Index (i5) adapter sequence:

https://emea.support.illumina.com/co...0002694-14.pdf

A standard i5 adapter = AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC

What should I order to amplify my transposed libraries? For example with the H502 i5 index: unique bases in adapter = CTCTCTAT, does that mean I would order a primer with the reverse complement (ATAGAGAG) for the unique portion of an i5 standard index? = AATGATACGGCGACCACCGAGATCTACAC [ATAGAGAG] TCGTCGGCAGCGTC instead of AATGATACGGCGACCACCGAGATCTACAC [CTCTCTAT] TCGTCGGCAGCGTC as was used in this protocol presumably becuase they used a different sequencer: https://www.encodeproject.org/docume...l_20170130.pdf

From the original ATAC-seq protocol, they add the following bases to the 3' end of a standard i5 adapter that doesn't contain a unique index sequence. I'd imagine this is to mitigate loss of the 8 base unique index, but they've also added a few bases to the 3' end of the i7 adapters (AGATGT) that do contain a unique index sequence. Should I include this (AGATGTG) to my i5 primer order and can I use these with the i7 adapters as given in the in the Buenrostro 2013 protocol which include the extra 3' bases (AGATGT)?

Best,
Eric

GenoMax · 08-24-2020, 10:51 AM

Cross-posted: https://www.biostars.org/p/457238/

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
Dual Indexing for NimbleGen SeqCap	geertvandeweyer	Sample Prep / Library Generation	1	05-22-2017 02:54 PM
Only one barcode present after dual indexing	k_a_r_o_l	Bioinformatics	3	03-11-2015 10:19 AM
demultiplexing with dual indexing	JBKri	Illumina/Solexa	1	10-18-2014 12:47 PM
Dual indexing on NextSeq	bryanbriney	Illumina/Solexa	1	06-19-2014 07:59 AM
96 or 384 Nextera-style dual indexing	pmiguel	Illumina/Solexa	3	06-27-2012 10:49 AM

08-24-2020, 05:57 AM	#1
ETBA Junior Member Location: UK Join Date: Sep 2018 Posts: 4	i5 / i7 dual indexing + ATAC Hello, I am constructing an ATAC-seq library using the standard Illumina kit (Nextera DNA Flex Library Prep, FC-121-1030). A previous user suggested dual indexing to minimise index hopping which I am grateful for. We have access to a Hiseq X-Ten (paired-end 100bp) and illumina suggests to use the reverse complement of the Index (i5) adapter sequence: https://emea.support.illumina.com/co...0002694-14.pdf A standard i5 adapter = AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC What should I order to amplify my transposed libraries? For example with the H502 i5 index: unique bases in adapter = CTCTCTAT, does that mean I would order a primer with the reverse complement (ATAGAGAG) for the unique portion of an i5 standard index? = AATGATACGGCGACCACCGAGATCTACAC [ATAGAGAG] TCGTCGGCAGCGTC instead of AATGATACGGCGACCACCGAGATCTACAC [CTCTCTAT] TCGTCGGCAGCGTC as was used in this protocol presumably becuase they used a different sequencer: https://www.encodeproject.org/docume...l_20170130.pdf From the original ATAC-seq protocol, they add the following bases to the 3' end of a standard i5 adapter that doesn't contain a unique index sequence. I'd imagine this is to mitigate loss of the 8 base unique index, but they've also added a few bases to the 3' end of the i7 adapters (AGATGT) that do contain a unique index sequence. Should I include this (AGATGTG) to my i5 primer order and can I use these with the i7 adapters as given in the in the Buenrostro 2013 protocol which include the extra 3' bases (AGATGT)? Best, Eric

08-24-2020, 10:51 AM	#2
GenoMax Senior Member Location: East Coast USA Join Date: Feb 2008 Posts: 7,091	Cross-posted: https://www.biostars.org/p/457238/