SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > 454 Pyrosequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
how to determine strand from tophat output for paired-end RNA-seq data jay2008 Bioinformatics 1 05-30-2012 05:46 AM
454 paired-end or single-end? ps376 454 Pyrosequencing 2 11-02-2011 08:33 AM
Pippen for 454 paired-end libraries? RCJK Sample Prep / Library Generation 0 07-03-2011 09:35 PM
Determine paired end overlapping chariko Bioinformatics 2 04-29-2011 12:52 AM
454 Paired End orientation problems pr0t3us Bioinformatics 5 06-03-2010 01:25 AM

Reply
 
Thread Tools
Old 09-29-2009, 06:20 PM   #1
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default How to determine 454 paired end adaptor sequence

I have a list of 454 sequence data read, for running the preprocessing step, I need to find out the adaptor sequence read first.
Do anybody know how to find out the adaptor sequence for the 454 paired-end sequence?
Is it 454 company using a standard adaptor sequence for all of their sequencing process technique?
edge is offline   Reply With Quote
Old 09-30-2009, 01:56 AM   #2
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

Passing on some information from a contact at Sanger regarding the paired end linker sequence:

454flx
GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
(palindromic)

454titanium
TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
(and also check for its reverse complement)

These are also given in the sffToCA documentation for the WGS assembler:
http://sourceforge.net/apps/mediawik...matting_Inputs

Last edited by maubp; 09-30-2009 at 02:13 AM. Reason: fixing typo
maubp is offline   Reply With Quote
Old 09-30-2009, 02:33 AM   #3
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default

Thanks a lot for your explanation.
Do you have the list of paired-end adaptor sequence that using by 454 sequencing technique?
Can provide the suitable link or website for me to find out the paired-end adaptor sequence that using by 454 sequencing technique?
Thanks a lot for your help

Quote:
Originally Posted by maubp View Post
Passing on some information from a contact at Sanger regarding the paired end linker sequence:

454flx
GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
(palindromic)

454titanium
TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
(and also check for its reverse complement)

These are also given in the sffToCA documentation for the WGS assembler:
http://sourceforge.net/apps/mediawik...matting_Inputs
edge is offline   Reply With Quote
Old 09-30-2009, 02:39 AM   #4
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

The MIRA documentation gives a few adaptors, but warns that local sequencing centers may use their own specific ones:
http://chevreux.org/uploads/media/mi...tml#section_10
maubp is offline   Reply With Quote
Old 09-30-2009, 02:52 AM   #5
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default

Hi, thanks a lot again
Do you have any idea about the adaptor sequence using by 454 technique to sequence bacillus genome?

Quote:
Originally Posted by maubp View Post
The MIRA documentation gives a few adaptors, but warns that local sequencing centers may use their own specific ones:
http://chevreux.org/uploads/media/mi...tml#section_10
edge is offline   Reply With Quote
Old 09-30-2009, 06:33 AM   #6
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

Are you talking about getting your own data for bacillus by paying a local sequencing service? If so, your sequencing center should be able to tell you the adaptor/linker sequences they use - but it will probably be the default Roche 454 sequences.
maubp is offline   Reply With Quote
Old 09-30-2009, 06:24 PM   #7
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default

For 454 FLX sequencing data,

The sequence below is it the general 454 flx adaptor sequence?
454flx
GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
(palindromic)

When I using it because of palindromic, should I used this:

>454flx1
GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC

>454flx2
CAACCTTGGCTTTCCCAAACTTAAGTTTGGGAAAGCCAAGGTTG

I just checked, my data is 454 flx sequencing data, just I not sure about its adaptor sequence used for 454 flx.
Thanks for your help
Quote:
Originally Posted by maubp View Post
Are you talking about getting your own data for bacillus by paying a local sequencing service? If so, your sequencing center should be able to tell you the adaptor/linker sequences they use - but it will probably be the default Roche 454 sequences.
edge is offline   Reply With Quote
Old 10-01-2009, 12:49 AM   #8
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

Quote:
Originally Posted by edge View Post
For 454 FLX sequencing data,

The sequence below is it the general 454 flx adaptor sequence?
454flx
GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
(palindromic)
No - that is the linker sequence used for paired end reads.
maubp is offline   Reply With Quote
Old 10-01-2009, 12:51 AM   #9
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default

thanks a lot, I get it d
you are administrator,right?!
thanks for your guide so far

Quote:
Originally Posted by maubp View Post
No - that is the linker sequence used for paired end reads.
edge is offline   Reply With Quote
Old 10-01-2009, 01:08 AM   #10
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

Quote:
Originally Posted by edge View Post
thanks a lot, I get it d
you are administrator,right?!
thanks for your guide so far
No, I'm not a forum admin - just another user.

I'm sorry if I added to the confusion by talking about the paired end linker sequences when you were more interested in the adapter sequences. Hopefully things are clearer now
maubp is offline   Reply With Quote
Old 10-01-2009, 01:23 AM   #11
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default

haha..
thanks a lot for your help
Actually I confusing myself d...
I refer to the paired-end linker instead of paired-end adaptor sequence
I misunderstanding myself d
Besides that, do you familiar with some open source software, like SSAHA2?!

Quote:
Originally Posted by maubp View Post
No, I'm not a forum admin - just another user.

I'm sorry if I added to the confusion by talking about the paired end linker sequences when you were more interested in the adapter sequences. Hopefully things are clearer now
edge is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:24 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO