SEQanswers

Go Back   SEQanswers > Applications Forums > Epigenetics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Non-BS mismatch count in .SAM (esp. Bismark)? mixter Epigenetics 5 10-15-2012 05:57 AM
SAM tools question jsun529 Bioinformatics 1 05-31-2011 08:13 AM
question about bwa sam file peachgil Bioinformatics 1 04-06-2011 09:53 AM
SAM tools output question sowmyai Bioinformatics 5 07-11-2010 06:38 PM
Bfast output and "Empty Sequence Dictionary" in .sam output aiden Bioinformatics 1 05-28-2010 07:50 PM

Reply
 
Thread Tools
Old 02-12-2013, 09:54 AM   #1
serenaliao
Member
 
Location: Pittsburgh

Join Date: Jan 2013
Posts: 22
Default Question about sam output of Bismark

I am wondering if anyone has ever encountered similar problem. I used the latest version of Bismark for my data(pair end 100bp). After a closer look at the output sam file, I found there are some reads which is pretty short like this:
MWR-PRG-0014:95: D1HU8ACXX:6:1101:1417:2210_1:N:0:GCCAAT/1 115 chr5 75301330 255 100M = 75301318 -112 CAACCAAACAAAATACAACTATAAACTAAACTCTACCCATAAAACGCCTATTTACAAACTCCGTCCCCTAACCTAAAAAAACTAAAAAACCATTTCAAAC #B?@ACCBCDCB@AAADDC>>:
C@CCDA@:C:?>5BACCC=933CEBEEEEEE?HC=(A6DGGEEGIHEDBHCCFIIIIIGIHDC1EA4FHHDDD?D?;@ NM:i:23 XX:Z:2G14G2G1G1G2GG5G6GG6G3G7T7G4GGGG5GGGG10G2
XM:Z:..x..............x..x.h.h..xh.....x......hh..Z...x...h........X......x....xhhh.....xhhh..........x.. XR:Z:CT XG:Z:G
A
MWR-PRG-0014:95: D1HU8ACXX:6:1101:1417:2210_1:N:0:GCCAAT/2 179 chr5 75301318 255 100M = 75301330 -112 TCCCTCTCTCTACAACCAAACAAAATACAACTATAAACTAAACTCTACCCATAAAACGCCTATTTACAAACTCCGTCCCCTAACCTAAAAAAACTAAAAA @C@FFFDFHHFDHEEGIIGIJJ
JJJ<FGICFGJJIIGJIJJGJ@HIIIJJGGGIJEIBEHHIIIJIHEEEHHDFFFEACDD?CDDDDCD3@BDBDCC>CC NM:i:23 XX:Z:5T8G14G2G1G1G2GG5G6GG6G3G7T7G4GGGG5GGGG1-XM:Z:..............x..............x..x.h.h..xh.....x......hh..Z...x...h........X......x....xhhh.....xhhh. XR:Z:GA XG:Z:GA

which start at 75301318 and end at 75301330 at chromosome 5. (This is for Mmusculus mm9).
But if if get the exact sequence with mm9 by library BSgenome in R:

getSeq(Mmusculus, names= "chr5", start=75301318, end=75301330,as.character=TRUE)
[1] "TCCCTTTCTCTAC"

It seems it doesn't overlap with any bases in the read, then why is that map to the position.

Anyone knows the answer? I am curious to know. Thanks!
serenaliao is offline   Reply With Quote
Old 02-12-2013, 11:25 AM   #2
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 622
Default

If I am not mistaken then the first mapping position in SAM format is the position where the read starts, and the second one is where the second read starts and not where it ends. Does that make sense?
fkrueger is offline   Reply With Quote
Old 02-12-2013, 11:31 AM   #3
serenaliao
Member
 
Location: Pittsburgh

Join Date: Jan 2013
Posts: 22
Default

Quote:
Originally Posted by fkrueger View Post
If I am not mistaken then the first mapping position in SAM format is the position where the read starts, and the second one is where the second read starts and not where it ends. Does that make sense?
Ok, so in that case, the sequence between the two start position should still be mapped back to the sequence in the sam file right?
serenaliao is offline   Reply With Quote
Old 02-12-2013, 11:37 AM   #4
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 622
Default

Yes it should, but looking at the 12bp you posted they do agree. You have to keep in mind that Sam format always displays the sequence as the forward stand and your read seems to align to the reverse stand.
fkrueger is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:12 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO