SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Processing Barcoded Paired-end Reads anthonycychiu Bioinformatics 3 11-18-2014 11:27 AM
Isolating barcoded reads in .Bam file thedvorakian Bioinformatics 0 11-20-2013 09:48 AM
Extracting reads from barcoded pooled samples megh Bioinformatics 1 06-28-2011 12:42 AM
trimming barcoded sequences dawe Bioinformatics 7 03-26-2010 07:14 AM

Reply
 
Thread Tools
Old 09-01-2019, 09:26 AM   #1
lncRNA
Junior Member
 
Location: Connecticut

Join Date: Aug 2019
Posts: 1
Default Non-Barcoded reads. Why?

Hello everybody!

I am pretty new in the NGS jungle and I am struggling with the making sense of some NGS data. I hope someone can help me out:

I have built a library with internal Barcodes which looks like the following:
SolexaP5-NNNN-Barcode-NNNN-DNAinsert-SolexaP3
N=random nucleotides to collapse PCR duplicates
SolexaP5:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
SolexaP3:CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC


Unfortunately, after Barcode splitting, I noticed that I have many reads with no Barcode.

Does any of you have an explanation why I get such non-barcoded reads?

Any input would be much appreciated

Thanks in advance!

lncRNA is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:07 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO