TruSeq DNA - need index/barcode-specific primers

[drops]

Hi there,
I have to pool libraries from different sources and labs. One of our collaborator don't have the index information of his library anymore. So I would like to check if sample XY really has the barcode e.g. #12.

Does someone of you have a primer design suggestion? Or even a Sequence for me?

Thx,
Drops

[drops]

anyone has the same problem?
Having a indexed library and try to find out which barcode is attached to this library?

[TonyBrooks]

Log into your Illumina account. There is a document detailing the Illumina primer sequences.

[kmcarr]

Hi there,
I have to pool libraries from different sources and labs. One of our collaborator don't have the index information of his library anymore. So I would like to check if sample XY really has the barcode e.g. #12.

Does someone of you have a primer design suggestion? Or even a Sequence for me?

Thx,
Drops

Personally, if a researcher submitted a library to me and said "Sorry, I forgot what barcode I used." I would be telling that researcher the s/he will be buying for a full lane of sequencing for this library (i.e. the barcode will be irrelevant) because I'm not going to waste my time cleaning up their mess.

[HESmith]

I agree with kmcarr. The barcode may be identical to one of the other samples, so you cannot safely multiplex the unknown with the others.

[cumulonix]

Sanger Sequence verify the index!

If I was given a sample that cannot be re-prepped (with known truseq adapters), I would
1) PCR amplify a small fraction of the sample with small primers at the beginning of the forward universal adapter (say: AATGATACGGCGACCACCGAGATCTAC) and the beginning of the rev adapter (before the truseq index region) (say : GATCGGAAGAGCACACGTCTGAACTCCAG).
2) Sanger sequence the purified PCR product with the fwd primer. The sample itself will be degenerate (Ns) but you should see the truseq adapter sequence at the end.

A better strategy is to attach the required adapter by PCR, and run the sequencing experiment!