SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Small Adapter Dimer Can Cause Big Troubles! pmiguel Illumina/Solexa 14 03-04-2015 03:16 PM
Adapter Dimer Structure bionop Illumina/Solexa 0 02-15-2015 11:03 AM
adapter dimer yfondyfe Introductions 3 10-06-2014 03:34 AM
structure of an adapter-dimer woshiliangliang Sample Prep / Library Generation 3 07-16-2014 06:56 PM
Rapid Library Adapter Dimer Br3ndan Sample Prep / Library Generation 1 05-05-2011 04:36 AM

Reply
 
Thread Tools
Old 09-22-2015, 02:19 PM   #1
shr19818
Junior Member
 
Location: alabama

Join Date: Sep 2015
Posts: 1
Default adapter dimer sequence structure

Hi All,

I'm trying to track how the artifact adapter dimer sequence are structured. So far I see dimers of Illumina Paired End PCR primer heavily represented in miseq run reads. So contrary to our assumption of Adaptor1-Adaptor2 ligation, I'm observing adaptor2-adaptor2. I'm baffled of how that can come about biochemically? any views on this appreciated.

dimer sequence I'm observing frequently:

GATCGGAAGAGCGGTTCAGCAGGAATGCCGA-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG

Last edited by shr19818; 09-22-2015 at 08:47 PM.
shr19818 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:07 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO