SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
SAM format: single vs multiple hits darked89 Bioinformatics 1 07-17-2012 12:29 PM
Multiple hits from BLAT? thsuk1 Bioinformatics 2 09-21-2010 01:13 AM
BWA sampe multiple hits question sahar Bioinformatics 0 08-03-2010 02:20 PM
Maq multiple hits file Lesley Bioinformatics 1 12-09-2009 04:12 AM
maq multiple hits information? baohua100 Bioinformatics 15 08-13-2009 02:31 PM

Reply
 
Thread Tools
Old 10-04-2010, 06:59 AM   #1
EthoStrain
Junior Member
 
Location: Cambridge, MA

Join Date: Sep 2010
Posts: 7
Default BWA Multiple Hits

I have been using BWA to much success, except one small issue. When I do an alignment I only get back one result per read, but I know that I should be getting more than just a single result.

I have tried using -N and -R but my output has not changed. Could anyone give me some guidance?

Thanks!
EthoStrain is offline   Reply With Quote
Old 10-04-2010, 03:45 PM   #2
EthoStrain
Junior Member
 
Location: Cambridge, MA

Join Date: Sep 2010
Posts: 7
Default A bit clearer

I have narrowed it down so that I know BWA is returning only one hit per read per fasta file. I still am unsure why -N is not working as it claims to return all hits.
I know that bowtie has an 'all' option so I may just go with bowtie instead.

Thanks!
EthoStrain is offline   Reply With Quote
Old 10-07-2010, 08:30 AM   #3
epigen
Senior Member
 
Location: Germany

Join Date: May 2010
Posts: 101
Default

Do you mean the -N from aln? That would not make much sense:
-N Disable iterative search. All hits with no more than maxDiff differences will be found. This mode is much slower than the default.

or that from sampe?
-N INT Maximum number of alignments to output in the XA tag for disconcordant read pairs (excluding singletons). If a read has more than INT hits, the XA tag will not be written. [10]

I guess you'll want to use -n from samse/sampe. This will still return one "main" hit but report the others in the XA tag:
-n INT Maximum number of alignments to output in the XA tag for reads paired properly. If a read has more than INT hits, the XA tag will not be written. [3]

looks like that for a (single end) read with 3 possible locations:
3_32_497 16 chr2 180106465 0 48M * 0 0 CGGTGAAACCCTGTCTCTACTAAAAATACAAAAAATTAGTCAGGCATG .... XA:Z:chr13,-27690265,48M,1;chr16,-85778252,48M,1;

Just set -n <bignumber> to get as many locations as you like and extract them with a script.
epigen is offline   Reply With Quote
Old 10-07-2010, 09:37 PM   #4
EthoStrain
Junior Member
 
Location: Cambridge, MA

Join Date: Sep 2010
Posts: 7
Default Works!

Yes, that was exactly what I was missing. Thank you very much!
EthoStrain is offline   Reply With Quote
Old 02-20-2012, 08:02 AM   #5
cfrias
Junior Member
 
Location: barcelona

Join Date: Jan 2011
Posts: 5
Default

Hi,

I am working with 454 data.
I try to obtain alternative Hits with the bwasw algorithm, Can somebody help, me please?
cfrias is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:10 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO