Hi,
It is explained in several places such as here
that the adapters ligated to the DNA library in many library prep workflows contain a T overhang, which is complementary to an A overhang, that one needs to install on the library to be sequenced, resulting, to my understanding, in such fragments:
5'-Adapter-T-Library-A-Adapter-3'
Now, the website above mentions that
the Read1 primer is ACACTCTTTCCCTACACGACGCTCTTCCGATCT, which I think corresponds to the adapter + the additional T, and
the Read2 primer is GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, which, again, I believe is adapter + the T.
So far so good, weren't it for the fact that I have recently made my own libraries for a myseq run without adapter ligation, where I simply added P5/7 and adapter in a single PCR, and for which I used these primers:
P5: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-binding-region-3'
P7: 5’-CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-binding-region-3'
I got these primers from a colleague, and as you may see, while the P5 primer contains the final T, the P7 primer does not. That means, that my PCR-made libraries looked like this:
5'-Adapter-T-Library-Adapter-3'
Confusingly, the sequencing run went just fine (and so have runs where my colleagues used these primers) and when I look into the sequenced fragments, indeed there is no extra A between the library and the 3' adapter. I checked some old sequencing data where I did follow an adapter ligation protocol, looked at forward reads that read into the adapter part, and there I see the extra A after my library.
So clearly, I must be missing something here, because if the Read2 primer indeed contains a T on the 3' end, then the read on my PCR libraries really should fail, because that final T on the primer has nothing to bind to in these constructs, will flap around, and the polymerase won't extend the primer.
I know that there are other library prep methods out there that don't rely on A/T ligation, so I wonder if anyone knows if they typically introduce that T/A anyway, or if the resulting adapters are there without the T/A? Could it be that the Read2 primer doesn't actually contain the final T and ignores base 1 if it turns out to be all As?
Thanks,
Max
It is explained in several places such as here
that the adapters ligated to the DNA library in many library prep workflows contain a T overhang, which is complementary to an A overhang, that one needs to install on the library to be sequenced, resulting, to my understanding, in such fragments:
5'-Adapter-T-Library-A-Adapter-3'
Now, the website above mentions that
the Read1 primer is ACACTCTTTCCCTACACGACGCTCTTCCGATCT, which I think corresponds to the adapter + the additional T, and
the Read2 primer is GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, which, again, I believe is adapter + the T.
So far so good, weren't it for the fact that I have recently made my own libraries for a myseq run without adapter ligation, where I simply added P5/7 and adapter in a single PCR, and for which I used these primers:
P5: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-binding-region-3'
P7: 5’-CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-binding-region-3'
I got these primers from a colleague, and as you may see, while the P5 primer contains the final T, the P7 primer does not. That means, that my PCR-made libraries looked like this:
5'-Adapter-T-Library-Adapter-3'
Confusingly, the sequencing run went just fine (and so have runs where my colleagues used these primers) and when I look into the sequenced fragments, indeed there is no extra A between the library and the 3' adapter. I checked some old sequencing data where I did follow an adapter ligation protocol, looked at forward reads that read into the adapter part, and there I see the extra A after my library.
So clearly, I must be missing something here, because if the Read2 primer indeed contains a T on the 3' end, then the read on my PCR libraries really should fail, because that final T on the primer has nothing to bind to in these constructs, will flap around, and the polymerase won't extend the primer.
I know that there are other library prep methods out there that don't rely on A/T ligation, so I wonder if anyone knows if they typically introduce that T/A anyway, or if the resulting adapters are there without the T/A? Could it be that the Read2 primer doesn't actually contain the final T and ignores base 1 if it turns out to be all As?
Thanks,
Max