SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Extracting fasta sequence from bam file with bed intervals hin175 Bioinformatics 5 08-04-2015 08:44 AM
extracting identical reads from bam file Schelarina Bioinformatics 6 08-24-2014 02:32 PM
Extracting Novel transcript sequence from RNA-seq alignment sahilsukla Introductions 0 08-09-2012 12:19 AM
Extracting (Slicing) a BAM file ashkot Bioinformatics 4 12-13-2011 12:02 PM
Extracting Reference Sequence from a bam File andy11 Bioinformatics 6 12-13-2010 03:06 PM

Reply
 
Thread Tools
Old 08-04-2015, 03:16 AM   #1
dena.dinesh
Member
 
Location: Europe

Join Date: Feb 2013
Posts: 58
Default extracting complete sequence for every transcript from a bam file

hi,

I have bam obtained by aligning to a transcriptome. Is it possible to obtain the complete sequence that has been aligned to every transcript and make a fast file out aligned sequences for every transcript. For an example, if the complete aligned sequence with respect to reference trasncript is like
Code:
>ref_tr1
aggtcgtttagtcgatatcgtga
>aln_tr1
a-gtcgtttagtcgat-tcgtga
I would like to obtain a fasta file containing only aligned trasncripts like
Code:
>aln_tr1
a-gtcgtttagtcgat-tcgtga
>aln_tr2
agtgtcgggctgag--gcg-cc
How can I obtain this fast file from aligned bam file. Kindly guide me.
Thanks in advance

Last edited by dena.dinesh; 08-04-2015 at 03:27 AM.
dena.dinesh is offline   Reply With Quote
Old 08-13-2015, 08:21 AM   #2
rnaeye
Member
 
Location: East Cost

Join Date: May 2011
Posts: 79
Default

Of course it's possible. You can use "bedtools."
rnaeye is offline   Reply With Quote
Reply

Tags
bam, rnaseq, samtools

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:10 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO