
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
how use bowtie2 output sam file for magan5 input Ybanet Introductions 0 02-16-2016 02:48 AM
sam file as input in velvet vishwesh Bioinformatics 1 02-26-2014 03:50 AM
Unable to find flag in SAM with bowtie2 - but can with BWA yekwah Bioinformatics 3 10-18-2013 09:20 AM
BWASW more reads in the output SAM file than in the input file nanto Bioinformatics 2 09-18-2012 01:41 AM
wig file generated by MACS doesn`t fit input sam tujchl Bioinformatics 2 06-16-2011 01:23 AM

Thread Tools
Old 10-24-2016, 02:21 PM   #1
Junior Member
Location: Perpignan

Join Date: May 2011
Posts: 5
Default Bug with eXpress: Unable to open input SAM file

Dear all ,
I tried to use eXpress to count the mapping results obtained with Bowtie2.

The command used is
express -m 450 -s 100 --no-update-check transcriptome.fasta MT121_3_sorted.bam

however I obtain the following error message when I used a BAM file as input:
2016-Oct-21 23:34:59 - Attempting to read 'MT121_3_sorted.bam' in BAM format...
2016-Oct-21 23:34:59 - Input is not in BAM format. Trying SAM...
2016-Oct-21 23:34:59 - SEVERE: Unable to open input SAM file '/MT100_3.sam'.

and this one if I use a SAM file as input
2016-Oct-24 21:01:27 - SEVERE: Unable to open input SAM file '/MT121_3_sorted.sam'.
2016-Oct-24 21:01:27 - Attempting to read '/MT121_3_sorted.sam' in BAM format...
2016-Oct-24 21:01:27 - Input is not in BAM format. Trying SAM...

The sam look like a reel SAM :
@HD VN:1.0 SO:coordinate
@SQ SN:c1_g1_i1 LN:241
@SQ SN:c1_g2_i1 LN:279
@SQ SN:c2_g1_i1 LN:319
@SQ SN:c2_g2_i1 LN:222
@SQ SN:c3_g1_i1 LN:642
@SQ SN:c4_g1_i1 LN:323
@SQ SN:c5_g1_i1 LN:234
@SQ SN:c6_g1_i1 LN:396
@SQ SN:c6_g2_i1 LN:351
@SQ SN:c8_g1_i1 LN:334
@SQ SN:c9_g1_i1 LN:214
@SQ SN:c10_g1_i1 LN:300
@SQ SN:c11_g1_i1 LN:432
@SQ SN:c12_g1_i1 LN:254
@SQ SN:c13_g1_i1 LN:282
@SQ SN:c15_g1_i1 LN:563
@SQ SN:c79885_g1_i1 LN:204
@SQ SN:c79886_g1_i1 LN:243
@PG ID:bowtie2 PN:bowtie2 VN:2.1.0
HWI-ST909:410:C8P7RACXX:6:1203:6648:51518 147 c1_g2_i1 136 40 100M = 100 -136 ACTCTGATATTCTCTGCATCCACTGTAAATGTTCATCATTGGCACATGTT
HWI-ST909:410:C8P7RACXX:6:1304:8532:81357 147 c1_g2_i1 144 42 100M = 24 -220 ATTCTCTGCATCCACTGTAAATGTTCATCATTGGCACATGTTCCCGCAGA
HWI-ST909:410:C8P7RACXX:6:2106:12948:92662 99 c4_g1_i1 53 42 100M = 100 147 GTCAGACTTAGACGATGAGTACCTGAGATTATTTTTGTAGTATTTGATGT
:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:72G27 YS:i:-6 YT:Z:CP
:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:56G43 YT:Z:UP
HWI-ST909:410:C8P7RACXX:6:2106:12948:92662 147 c4_g1_i1 100 42 100M = 53 -147 TGTCAGATCCACCTCTGACCCAGCCAATCTTCTTCTGCTGAGCATTTTTC
:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:25G74 YS:i:-6 YT:Z:CP

Does anyone have an idea to solve this problem ?

Best regards,
Trevaly is offline   Reply With Quote

bam, bug, express, sam

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 09:21 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO