SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Bowtie alignment for ChIP-seq: good alignment for input but not for ChIP sample nico_z Bioinformatics 2 03-20-2013 11:19 AM
How to build the fly genome in Bowtie lilithdog General 1 12-17-2009 04:18 AM

Reply
 
Thread Tools
Old 12-14-2014, 01:43 PM   #1
Karli_40
Junior Member
 
Location: Chicago

Join Date: Dec 2014
Posts: 6
Default RNA-seq alignment for fly with bowtie

HI Everyone,

When I did alignment for my cDNA sample to fly genome with bowtie, the id for each read was set to FBgn#. But if I want to view the result with UCSC genome browser, I think the ID need to be chromosome location. Is there options in bowtie that when we do the alignment, we can set the ID to chromosome location?

Thanks a lot in advance for help.
Karli_40 is offline   Reply With Quote
Old 12-15-2014, 04:08 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,087
Default

Is there a specific reason you want to visualize the data at UCSC? You could also use a local genome viewer like IGV from Broad.

Did you create the transcriptome indexes yourself or did you download them from somewhere? Can you post a few lines from your SAM file (the chromosome locations may already be there, skip reference sequence headers if they are included)?
GenoMax is offline   Reply With Quote
Old 12-23-2014, 12:37 PM   #3
Karli_40
Junior Member
 
Location: Chicago

Join Date: Dec 2014
Posts: 6
Default

Right now I already have the mapped data. But if there is an option to use chromosome localization, I can do it again by myself.
Here is an example:
HWI-ST484:183:C167BACXX:7:1103:13372:100580 0 FBgn0035951 49 255 49M * 0 0 GTTGAATTGGAACTATTTTTTTGTTTTCGAAAACGGATAATTGCGAGCA aabeeeeeggfggiiiiiiiiiihiiiihihhiiiiiiiihiihiiiig XA:i:0 MD:Z:49 NM:i:0
Thanks~
Karli_40 is offline   Reply With Quote
Old 12-23-2014, 03:31 PM   #4
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,087
Default

I am afraid you are going to have to re-do the alignments if you want to visualize the data for chromosomal locations. I would suggest that you download the indexes/annotations from iGenomes site: http://support.illumina.com/sequenci...e/igenome.html for UCSC build.
GenoMax is offline   Reply With Quote
Old 12-23-2014, 04:59 PM   #5
Karli_40
Junior Member
 
Location: Chicago

Join Date: Dec 2014
Posts: 6
Default

Thanks, I will look there to find proper index. This is the example for the current index from flybase, I guess with this, I cannot get what I want no matter what...
but if I don't need the transcript data, I can convert the gene information with a map table to chromosome localization.

>FBtr0071764 type=mRNA; loc=2R:join(22137433..22138251,22151654..22151695,22162905..22163694,22164777..22164989,22169244..22170717,22170778..22171985,22172082..22172252,22172316..22172433,22172497..22172834); ID=FBtr0071764; name=a-RB; dbxref=FlyBase_Annotation_IDs:CG6741-RB,FlyBase:FBtr0071764,REFSEQ:NM_079902,REFSEQ:NM_079902; score=7; score_text=Moderately Supported; MD5=b3804d1c3dd8c6afd72ec955dc6c8c3b; length=5173; parent=FBgn0000008; release=r6.03; species=Dmel;
CGAATACACAAATCAAAGCAAGTGTCTGTGTGATTGTAAAGAAGAATGTGCTAAGCAAATAAGGCAAATAACAACCATA
TAACTGTAACTGAAATCCCACACTGAGAAAATAATCAGCGAAGAATAATATTTTGACATCCGTCTCTTGAAATATAAGA
TCAAACTTTAGGTTAATACTCATTAGAAATATATCAATAAGCTATGAAATATCATTTAAATAAAAATGTAGTGATCTTA
TTTTCATTTTTCTTCGTGCTCTCATAAGACAAGTTGATTGATTTGCGCAAAGGGAATTCGAGACACTTAAGATATTACC
Karli_40 is offline   Reply With Quote
Reply

Tags
alignment, bowtie, chromosome location, drosophila

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:00 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO