SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Short Read Micro re-Aligner (beta release) nilshomer Bioinformatics 27 04-17-2014 09:29 AM
short read aligner with 3 mismatch and one gap allowed NicoBxl Bioinformatics 2 11-09-2011 11:26 AM
The best short read aligner Deutsche Bioinformatics 4 04-14-2011 08:12 PM
Short Read Micro re-Aligner Paper nilshomer Literature Watch 0 10-29-2010 10:59 AM
Very Short Read aligner Rupinder Bioinformatics 1 06-02-2009 08:10 PM

Reply
 
Thread Tools
Old 11-03-2008, 05:18 PM   #41
sparks
Senior Member
 
Location: Kuala Lumpur, Malaysia

Join Date: Mar 2008
Posts: 126
Default

Hi Valentina,
The difference is how we treat a read that has multiple alignment locations. In this example with -rNone if a read has multiple laignment location then none of the laignmnet locations are reported. The read is still reported with a astatus of 'R'

@071113_EAS56_0053:2:1:205:775 S GGAATGGAATAGAATGGAATGGAATCGAATGGAAAG IIIIIIIIIIII-AIGI)>8@4'2.,0&-+(3!&%( R 27
@071113_EAS56_0053:2:1:208:823 S GTTGTGTCAATGCTATGTTCTCTTAACTACTATAGG IIIIIIIII0IIII(DI1III@>I)-:G-37&&)'% U 10 90 >gi|89161207|ref|NC_000004.10|NC_000004 115114504 R
@071113_EAS56_0053:2:1:216:778 S GGAGGGGGGAGGGATACCATTAGGAGATATACCTAC IIIIIIIII+III,801.,.109/#-$).5+*'&(" R 20
@071113_EAS56_0053:2:1:220:530 S GGAGGGATGAGTGTGGCCGCCTGAGCCAGGGCCGGG IIIIII,9;AI1C35=$+*!'&(%*#)#&&%%!$!% U 56 0 >gi|89161205|ref|NC_000003.10|NC_000003 113204473 F
@071113_EAS56_0053:2:1:222:845 S GAATTTGCATTTCTCCTAAGTTCCCAGGTGGTGCAC I2IIIIII;IIIIIIII),?3C<48%.,(+1&*&%* U 12 82 >gi|89161210|ref|NC_000006.10|NC_000006 27620264 F
@071113_EAS56_0053:2:1:223:509 S GATGAAATAATCTGTACAACAAACCCCCCTGCCACA I>II@>AIIIIIII:;E+>5*2,,4+50$&&"+'+% R 265

This is the same set of reads with -rR. In this case one of the alignment locations will be chosen at random (based on probability of being the correct one) and reported.

@071113_EAS56_0053:2:1:205:775 S GGAATGGAATAGAATGGAATGGAATCGAATGGAAAG IIIIIIIIIIII-AIGI)>8@4'2.,0&-+(3!&%( R 16 0 >gi|89161220|ref|NC_000024.8|NC_000024 57288157 R
@071113_EAS56_0053:2:1:208:823 S GTTGTGTCAATGCTATGTTCTCTTAACTACTATAGG IIIIIIIII0IIII(DI1III@>I)-:G-37&&)'% U 10 67 >gi|89161207|ref|NC_000004.10|NC_000004 115114504 R
@071113_EAS56_0053:2:1:216:778 S GGAGGGGGGAGGGATACCATTAGGAGATATACCTAC IIIIIIIII+III,801.,.109/#-$).5+*'&(" R 19 0 >gi|89161216|ref|NC_000009.10|NC_000009 88834386 F
@071113_EAS56_0053:2:1:220:530 S GGAGGGATGAGTGTGGCCGCCTGAGCCAGGGCCGGG IIIIII,9;AI1C35=$+*!'&(%*#)#&&%%!$!% U 56 0 >gi|89161205|ref|NC_000003.10|NC_000003 113204473 F
@071113_EAS56_0053:2:1:222:845 S GAATTTGCATTTCTCCTAAGTTCCCAGGTGGTGCAC I2IIIIII;IIIIIIII),?3C<48%.,(+1&*&%* U 12 60 >gi|89161210|ref|NC_000006.10|NC_000006 27620264 F
@071113_EAS56_0053:2:1:223:509 S GATGAAATAATCTGTACAACAAACCCCCCTGCCACA I>II@>AIIIIIII:;E+>5*2,,4+50$&&"+'+% R 17 0 >gi|51511721|ref|NC_000005.8|NC_000005 130493655 F

The difference is that the status 'R' reads have now reported an alignment location.

Hope this helps explain it.

Best Regards, Colin
sparks is offline   Reply With Quote
Old 11-04-2008, 06:52 AM   #42
valeu
Member
 
Location: Paris

Join Date: Sep 2008
Posts: 69
Default

Hi Colin! Thank you for you reply!

Have I understood correctly that there is no difference between "-rR" and "-r Random"?

I think I found out why I don't get 'random' reads. This is because I use "-Q 70" flag. And 'random' reads have Q=0.

Cheers,
Valentina
valeu is offline   Reply With Quote
Old 11-04-2008, 07:06 AM   #43
valeu
Member
 
Location: Paris

Join Date: Sep 2008
Posts: 69
Default

Hey Colin,

and there are still no news about precompiled version of Novo* on Solaris?

Valentina
valeu is offline   Reply With Quote
Old 11-04-2008, 07:09 PM   #44
sparks
Senior Member
 
Location: Kuala Lumpur, Malaysia

Join Date: Mar 2008
Posts: 126
Default

Hi Valentina,

You're right on both counts. For options, in most cases the space between optionletter and value is optional. And for -o & -r options you only need eneter enough letters to uniquely identify the option value.

With regard Solaris, I've installed Open Solaris under Vmware on my workstation but it has a few problems, it's not recognising my network or my USB drive, so I haven't been able to transfer any files to it.
I have no trouble with Vmware and other flavours of Linux.

Colin
sparks is offline   Reply With Quote
Old 07-05-2009, 09:28 PM   #45
seq_GA
Senior Member
 
Location: Asiana

Join Date: Feb 2009
Posts: 124
Default

Hi Colin,

I am wondering whether novocraft 2.04 version is free to download for reaserch purpose?
All the features available under http://www.novocraft.com/downloads/downloadpage.php are avilable for free version?
Please confirm

Thanks

Last edited by seq_GA; 07-05-2009 at 09:33 PM.
seq_GA is offline   Reply With Quote
Old 07-05-2009, 09:36 PM   #46
zee
NGS specialist
 
Location: Malaysia

Join Date: Apr 2008
Posts: 249
Default

The latest V2.05 is available to download for not-for-profit and research use. There are no restrictions if you would like to use it in your research work.

Added features e.g. BS-alignemnt, multithreading, etc are available in the 'Pro'/commercial version.

Quote:
Originally Posted by seq_GA View Post
Hi Colin,

I am wondering whether novocraft 2.04 version is free to download for reaserch purpose?

Thanks
zee is offline   Reply With Quote
Old 07-05-2009, 10:05 PM   #47
sparks
Senior Member
 
Location: Kuala Lumpur, Malaysia

Join Date: Mar 2008
Posts: 126
Default

Novoalign is still available free for use in non-profit organizations but some of the new features are disabled. The free version will do DNA, miRNA, RNA alignment of single end and paired end reads.
The commercial versions adds multi-threading, bi-seq alignment, base quality calibration and buying a license also helps fund further development.

Colin
sparks is offline   Reply With Quote
Old 08-26-2009, 04:57 AM   #48
BAJ
Member
 
Location: Paris

Join Date: Nov 2008
Posts: 15
Default sequence identifiers like >chrY_random

retracting comment. I have to check some more on my side first.
Sorry,
Bernd

Last edited by BAJ; 08-26-2009 at 05:41 AM. Reason: see comment
BAJ is offline   Reply With Quote
Old 08-26-2009, 09:01 AM   #49
sparks
Senior Member
 
Location: Kuala Lumpur, Malaysia

Join Date: Mar 2008
Posts: 126
Default

It's OK. Some copies of Human Genome have some additional sequence files like:

chr7_random.fa
>chr7_random
gatcatgctattgcactccagcctgggcgacagagtgaaactccatctca
gaaaaaataaataaaTGAGAGGATCAGCCAACGCATCAGCAAATGTCAGC
CGGACGGTTTAATTTCCACTCATCCCACGACACGAGGCAACCCTCAAACA
CACAGGTCCTGGCCATGAAGCCTTCAGGGAATCACAGGACTGGGTGCTGA
CCCAGAAAACTCTACAAAGCTTTGTGACCAAAGAGGTTCGAGTCCCAAGT
CCCCTTCAGGAAGAGCTGCAGTCTGCTCATGtgtctaagtttgcctctgt
tgcttataacaacataccggaaactgggtaaattataaaggaaaggcatt
tatttctcacagttatgaggctggataaatccagggtcgagtggccacaa
tggctttcttgctggaggggacttttcagggttcccaggtggcacaggcc

Some of these must have been included in your index build.
Colin
sparks is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:39 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO