SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
454 quality score, z-score,.. nii 454 Pyrosequencing 4 10-15-2020 07:29 AM
BLAST+ creating custom blast database and using blast+ filtering features deniz Bioinformatics 3 07-07-2019 09:04 AM
BLAST database error - when changing to new BLAST+ local program biobio Bioinformatics 4 06-15-2011 06:20 AM
Raw error rate calculation: JohnK Bioinformatics 1 12-28-2010 03:09 PM
Fastq quliaty score and MAQ output quality score baohua100 Bioinformatics 1 02-19-2009 10:21 AM

Reply
 
Thread Tools
Old 08-23-2010, 07:51 AM   #1
fungs
Member
 
Location: DE/SE

Join Date: Jan 2010
Posts: 10
Default Blast raw score calculation

Hello,

I know this sounds strange but I am having problems to validate the BLAST raw alignment scores (not the bit scores). Here an example alignment:

-------------------------------------------------------

Query: 100009 (Length=100)

Hit: NZ_ABBZ01004690 gi|153879981|ref|NZ_ABBZ01004690.1| Beggiatoa sp. PS, whole genome shotgun sequence
Length=280

Score = 176 bits (194), Expected = 6e-42
Identities = 99/100 (99%), Gaps = 0/100 (0%)
Strand=Plus/Minus

TCTGTTCTGTTCCATTGATCTATATCTCTGTTTTGGTACCAGTACCATGCTGTTTTGGTTACTGTAGCCTTGTAGTATAGTTTGAAGTCAGGTAGCGTGA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
TCTGTTCTGTTCCATTGATCTATATCTCTGTTTTGGTACCAGTACCATGCTGTTTTGGTTACTGTAGCCTTGTAGTATAGTTTGAAGTCAGGTAGTGTGA

-------------------------------------------------------

My scoring matrix is:
match: 2
mismatch: -3
gap open: 5
gap extension: 2

Following the formula from the NCBI web site http://www.ncbi.nlm.nih.gov/Educatio...t_Scores2.html (and what other aligners produce as raw score) this makes

99*2 - 3 = 195 and not 194 like BLAST says:

<Hsp_num>1</Hsp_num>
<Hsp_bit-score>176.213077892943</Hsp_bit-score>
<Hsp_score>194</Hsp_score>
<Hsp_evalue>6.28580662796915e-42</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>100</Hsp_query-to>
<Hsp_hit-from>108</Hsp_hit-from>
<Hsp_hit-to>9</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>99</Hsp_identity>
<Hsp_positive>99</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>100</Hsp_align-len>

In fact I noticed that all BLAST raw scores are even! I am using BLAST version 2.2.22+. Do I miss an import point here?
fungs is offline   Reply With Quote
Old 08-25-2010, 08:39 PM   #2
robs
Senior Member
 
Location: San Diego, CA

Join Date: May 2010
Posts: 116
Default

Did you try to use BLAST+ instead? If the problem does occur with BLAST+, I would switch. You might also want to update to the latest BLAST version.
robs is offline   Reply With Quote
Old 08-26-2010, 04:08 AM   #3
fungs
Member
 
Location: DE/SE

Join Date: Jan 2010
Posts: 10
Default

Yes, I am using BLAST+. I am currently running the latest version to see whether it makes any difference. Anyhow, this shoudn't be if it is really a bug. I couldn't find anything about it in the change logs from 2.2.22+ to 2.2.24+ so I rather think that it will give the same results with the latest version. What do you mean by "you should switch"?
fungs is offline   Reply With Quote
Old 08-26-2010, 09:45 AM   #4
robs
Senior Member
 
Location: San Diego, CA

Join Date: May 2010
Posts: 116
Default

If the raw score is a huge issue for you, you might want to consider alternative alignment programs (switch to an alternative program).
You could also try to write the NCBI people who wrote the BLAST+ paper.
robs is offline   Reply With Quote
Old 08-27-2010, 02:21 AM   #5
fungs
Member
 
Location: DE/SE

Join Date: Jan 2010
Posts: 10
Default

Yes thanks, I counterchecked with the latest BLAST+ version and found the same issue. The raw score is important to me because when I compare different aligners using the same scoring scheme should result in more or less the same alignments with the same raw scores.

Another point is that BLAST bit scores are calculated from the raw scores. This would mean that also the bit scores are slightly wrong!

I will write them an email, unfortunately they don't have a developers mailing list at the NCBI...
fungs is offline   Reply With Quote
Old 09-06-2010, 06:59 AM   #6
fungs
Member
 
Location: DE/SE

Join Date: Jan 2010
Posts: 10
Default

Just to let you know: Here is some evidence on the issue. I checked different versions and engines of NCBI BLAST. This seems to be an optimization in the code that is on purpose. The effect is that raw score can differ up to 3 points from real score.

blast2.2.24+:

* * * <Parameters_expect>10000</Parameters_expect>
* * * <Parameters_sc-match>2</Parameters_sc-match>
* * * <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
* * * <Parameters_gap-open>5</Parameters_gap-open>
* * * <Parameters_gap-extend>2</Parameters_gap-extend>
* * * <Parameters_filter>F</Parameters_filter>

* * * * * * * <Hsp_num>1</Hsp_num>
* * * * * * * <Hsp_bit-score>176.213077892943</Hsp_bit-score>
* * * * * * * <Hsp_score>194</Hsp_score>
* * * * * * * <Hsp_evalue>6.28580662796915e-42</Hsp_evalue>
* * * * * * * <Hsp_query-from>1</Hsp_query-from>
* * * * * * * <Hsp_query-to>100</Hsp_query-to>
* * * * * * * <Hsp_hit-from>108</Hsp_hit-from>
* * * * * * * <Hsp_hit-to>9</Hsp_hit-to>
* * * * * * * <Hsp_query-frame>1</Hsp_query-frame>
* * * * * * * <Hsp_hit-frame>-1</Hsp_hit-frame>
* * * * * * * <Hsp_identity>99</Hsp_identity>
* * * * * * * <Hsp_positive>99</Hsp_positive>
* * * * * * * <Hsp_gaps>0</Hsp_gaps>
* * * * * * * <Hsp_align-len>100</Hsp_align-len>
* * * * * * *
<Hsp_qseq>TCTGTTCTGTTCCATTGATCTATATCTCTGTTTTGGTACCAGTACCATGCTGTTTTGGTTACTGTAGCCTTGTAGTATAGTTTGAAGTCAGGTAGCGTGA</Hsp_qseq>
* * * * * * *
<Hsp_hseq>TCTGTTCTGTTCCATTGATCTATATCTCTGTTTTGGTACCAGTACCATGCTGTTTTGGTTACTGTAGCCTTGTAGTATAGTTTGAAGTCAGGTAGTGTGA</Hsp_hseq>
* * * * * * *
<Hsp_midline>||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
</Hsp_midline>

================================================================================
blast2.2.24:

* * * <Parameters_expect>10000</Parameters_expect>
* * * <Parameters_sc-match>2</Parameters_sc-match>
* * * <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
* * * <Parameters_gap-open>5</Parameters_gap-open>
* * * <Parameters_gap-extend>2</Parameters_gap-extend>
* * * <Parameters_filter>F</Parameters_filter>

* * * * * * * <Hsp_num>1</Hsp_num>
* * * * * * * <Hsp_bit-score>176.213</Hsp_bit-score>
* * * * * * * <Hsp_score>194</Hsp_score>
* * * * * * * <Hsp_evalue>6.28581e-42</Hsp_evalue>
* * * * * * * <Hsp_query-from>100</Hsp_query-from>
* * * * * * * <Hsp_query-to>1</Hsp_query-to>
* * * * * * * <Hsp_hit-from>9</Hsp_hit-from>
* * * * * * * <Hsp_hit-to>108</Hsp_hit-to>
* * * * * * * <Hsp_query-frame>1</Hsp_query-frame>
* * * * * * * <Hsp_hit-frame>-1</Hsp_hit-frame>
* * * * * * * <Hsp_identity>99</Hsp_identity>
* * * * * * * <Hsp_positive>99</Hsp_positive>
* * * * * * * <Hsp_align-len>100</Hsp_align-len>
* * * * * * *
<Hsp_qseq>TCACGCTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGATCAATGGAACAGAACAGA</Hsp_qseq>
* * * * * * *
<Hsp_hseq>TCACACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGATCAATGGAACAGAACAGA</Hsp_hseq>
* * * * * * *
<Hsp_midline>|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
</Hsp_midline>

================================================================================

blast2.2.24-legacy:

* * * <Parameters_expect>10000</Parameters_expect>
* * * <Parameters_sc-match>2</Parameters_sc-match>
* * * <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
* * * <Parameters_gap-open>5</Parameters_gap-open>
* * * <Parameters_gap-extend>2</Parameters_gap-extend>
* * * <Parameters_filter>F</Parameters_filter>

* * * * * * * <Hsp_num>1</Hsp_num>
* * * * * * * <Hsp_bit-score>177.115</Hsp_bit-score>
* * * * * * * <Hsp_score>195</Hsp_score>
* * * * * * * <Hsp_evalue>3.36455e-42</Hsp_evalue>
* * * * * * * <Hsp_query-from>100</Hsp_query-from>
* * * * * * * <Hsp_query-to>1</Hsp_query-to>
* * * * * * * <Hsp_hit-from>9</Hsp_hit-from>
* * * * * * * <Hsp_hit-to>108</Hsp_hit-to>
* * * * * * * <Hsp_query-frame>1</Hsp_query-frame>
* * * * * * * <Hsp_hit-frame>-1</Hsp_hit-frame>
* * * * * * * <Hsp_identity>99</Hsp_identity>
* * * * * * * <Hsp_positive>99</Hsp_positive>
* * * * * * * <Hsp_align-len>100</Hsp_align-len>
* * * * * * *
<Hsp_qseq>TCACGCTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGATCAATGGAACAGAACAGA</Hsp_qseq>
* * * * * * *
<Hsp_hseq>TCACACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGATCAATGGAACAGAACAGA</Hsp_hseq>
* * * * * * *
<Hsp_midline>|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
</Hsp_midline>
fungs is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:27 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO