SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Annotate contigs with BLAST hit names; remove contigs with no hit Bueller_007 Bioinformatics 10 02-27-2013 11:22 AM
IMAGE: Iteratively Mapping and Assembly for Gap Elimination software clostridium40 Bioinformatics 0 09-08-2011 02:38 PM
how to remove N (gap) in sequences? chronix De novo discovery 3 03-08-2011 05:31 AM
BWA and Velvet : Anamolies in contigs and read mapping to reference apratap Bioinformatics 1 01-29-2010 01:44 PM
gap penalty in BWA Victory Bioinformatics 0 11-13-2009 12:40 PM

Reply
 
Thread Tools
Old 05-22-2011, 11:50 PM   #1
ketan_bnf
Member
 
Location: India

Join Date: Oct 2010
Posts: 59
Default Need Help, gap between two contigs formed by mapping

Hi all,

I have mapped reads to a ref seq using gsMapper and formed a contigs, now i want to extract & count length of the gap in reference sequence where no reads have mapped

Ref seq : AAGACTCGTGATCTGCTAGGCTCCTAAT
Alignme : AAGACTCGT---gap----AGGCTCCTAAT


How can i extract gap between two contigs using perl or bioperl?

Thanks.

Last edited by ketan_bnf; 05-22-2011 at 11:52 PM.
ketan_bnf is offline   Reply With Quote
Old 06-15-2011, 12:36 AM   #2
Soni
Member
 
Location: Nairobi

Join Date: Oct 2009
Posts: 11
Default

Hi,
You can parse the headers of the 454AllContigs.fna to get the start and stop coordinates of the reference mapped by that particular contig. By a simple loop to substract the latter start position from the former stop position in Perl you can work out the coordinates for the unmapped regions.

Alternatively, use 454AlignmentInfo.tsv.

Hope this helps.

Soni
Soni is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:08 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO