SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
MACS wig files on UCSC? yh253 Bioinformatics 5 08-30-2013 03:13 AM
cufflink doesn't like sam from bwasw lukas1848 Bioinformatics 1 01-16-2012 06:11 AM
conversion tool sam to wig jasonbcold Bioinformatics 3 04-18-2011 06:01 AM
Alternative Hits in BWA generated .sam jtladner Bioinformatics 1 06-09-2010 03:07 PM
WIG input file for CEAS (Cis-regulatory Element Annotation System) clariet Bioinformatics 3 04-09-2010 08:31 AM

Reply
 
Thread Tools
Old 06-15-2011, 08:03 PM   #1
tujchl
Member
 
Location: BEIJING, CHINA

Join Date: Sep 2009
Posts: 74
Default wig file generated by MACS doesn`t fit input sam

HI:
I use MACS to do my peak calling and visualize my results by uploading wig file to UCSC. when I check reads distributution I find a bizarre thing:

below is part of wig generated by MACS:
track type=wiggle_0 name="treated_cells_treat_chr7" description="Shifted Merged MACS tag counts for every 10 bp"
variableStep chrom=chr7 span=10
34041 1
34051 1
34061 1
34071 1
34081 1
34091 1
34101 1
.......

and below is part of sam from bowtie and set to MACS to generate wig above:
HWUSI-EAS455_0024_FC62N0TAAXX:4:51:4046:9759#0/1 0 chr7 34040 255 38M * 0 0 ATCCCCCAAAGCCTGATAGAGAGAAGATGCTCATTAAT IIHIIIIIIIIGIIIIIIIHHEIIIIIIIIIIIIIIII XA:i:0 MD:Z:38 NM:i:0
HWUSI-EAS455_0024_FC62N0TAAXX:4:3:4393:14415#0/1 0 chr7 34809 255 38M * 0 0 ATGAATATTTGCTTCCCCTTCCTAGTGTAATAGAGTAA IIIIIIIIIIIIIIIIIIIIGHIIIGIHIBIIIIEEGF XA:i:0 MD:Z:38 NM:i:0
HWUSI-EAS455_0024_FC62N0TAAXX:4:53:15681:3020#0/1 0 chr7 35541 255 38M * 0 0 TTGGGCAAAGGGAATGAACAGACACTTTTCAAAAGAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIII XA:i:0 MD:Z:38 NM:i:0
HWUSI-EAS455_0024_FC62N0TAAXX:4:110:10526:17907#0/1 0 chr7 35635 255 38M * 0 0 AGAAATGCAAATCAAAACCATAATGAGATACCATCTCA HH@H@GGDGEBDGBBDGEDGGBDBBEDBEBEEGGEGDD XA:i:0 MD:Z:38 NM:i:0
HWUSI-EAS455_0024_FC62N0TAAXX:4:103:15636:4650#0/1 0 chr7 35756 255 38M * 0 0 TGTTGTTGGGTGTGCAAATCAGTTCAATCATTGTGCAA IIIIIIIIIIHIHIIIIIIIGIIIIIIIHIIIIIIIIE XA:i:0 MD:Z:38 NM:i:0

you can see in sam file there is only one read mapping to position 340XX (I sort my sam file), and on wig file there are too many reads mapping to 340XX which can`t explain by reads shift.

can you help me? thanks

Last edited by tujchl; 06-15-2011 at 08:19 PM.
tujchl is offline   Reply With Quote
Old 06-16-2011, 01:11 AM   #2
Chipper
Senior Member
 
Location: Sweden

Join Date: Mar 2008
Posts: 324
Default

The wig will show the overlap of the shifted extended read for every 10th base, so there is nothing wrong with your file.
Chipper is offline   Reply With Quote
Old 06-16-2011, 01:23 AM   #3
tujchl
Member
 
Location: BEIJING, CHINA

Join Date: Sep 2009
Posts: 74
Default

Thank you for your replying Chipper
but I don`t understand you very well.
in the wig file there is one read located on the each bin of 34041, 34051, 34061.....
and there is only one read in sam which can be mapped to this region even after shifting that is 34040. My question is how do the other reads come from on wig file.
and what do you mean by overlap?
tujchl is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:27 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO