
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
bitwise flag in SAM file win804 Bioinformatics 25 02-04-2013 09:56 PM
Cufflinks SAM file sort problem AdamB RNA Sequencing 2 09-14-2010 02:44 AM
Aligner that outputs H2 flag in SAM file phalaenopsis Bioinformatics 0 08-04-2010 06:14 AM
.sam file downloading problem from modENCODE wenrongzeng Bioinformatics 0 04-15-2010 01:38 PM
Redundant(?) report problem in tophat .sam file? Gangcai Bioinformatics 2 03-16-2010 01:05 AM

Thread Tools
Old 07-28-2009, 07:57 AM   #1
Location: dublin

Join Date: Oct 2008
Posts: 10
Default SAM file flag problem

Hi all,
Is any body know what's the the flag means in the SAM file.
The Flag I got looks different with the SAM manual.


Here is a sample of my sam file.

HWI-EAS283:8:1:1:695#0 69 * 0 0 * * 0 0 NACAAGGCATTGTTGTTGCTATCATTGCTTGCAAGCAGGAATNGCTAATGGAAGACTTCTTTTTTTTTGTGTACTT %/:56465,577-91-265//:######################################################
HWI-EAS283:8:1:1:695#0 133 * 0 0 * * 0 0 AAANCGCTACGTAATGATTGCAGTGAGCACAGAGCGCCCTACTGCACTCCAGCCTGGGAAACAGAGCGCGATTCCG ############################################################################
HWI-EAS283:8:1:1:749#0 99 chr7 91549950 37 76M = 91550245 354 NACCTATCTTAATTACGTTTCAAAGTATATACTCTTTTATAANAAATGAGCTCCATAACTTAAAAGCTAGATAACA %0:<;;9::7779<;;99979707999;::9:;::9:<<75.%*5789197978599################### XT:A:U NM:i:3 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:3 XO:i:0 XG:i:0 MD:Z:0T41C31A1
HWI-EAS283:8:1:1:749#0 147 chr7 91550245 37 17S59M = 91549950 -354 ATTGTGTTAGACCGTGAGTCCATAAAAATATATAGAGGTAATCTGTGGGCGTTTAGTAAATGGTGGTCCTACNACT #####################################################################B6>%42B XT:A:M NM:i:12 SM:i:37 AM:i:37 XM:i:12 XO:i:0 XG:i:0 MD:Z:2A4C9T1T4A5A6C0T0G5T1T0T6T3
HWI-EAS283:8:1:1:1047#0 69 * 0 0 * * 0 0 NTTTTTTGTTCCTTTTTTTTCAAGAGGCCAGAGGCAGAGGCCNTTGTCATTTTCTGTGTGTCCAGGTAATTGCGTA %1:::98789:::999:::::985226#################################################
HWI-EAS283:8:1:1:1047#0 133 * 0 0 * * 0 0 ACCNCGCCTGCCGAGTTTTTCCTTTCTATATTCTTAGTCGTTAAGAATGTTCTATCATGTTGTAATTTTTGTAGTC 0###########################################################################
ptong7 is offline   Reply With Quote
Old 07-28-2009, 09:30 AM   #2
Nils Homer
nilshomer's Avatar
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285

Originally Posted by ptong7 View Post
Hi all,
Is any body know what's the the flag means in the SAM file.
The Flag I got looks different with the SAM manual.


Here is a sample of my sam file.

HWI-EAS283:8:1:1:695#0 69 * 0 0 * * 0 0 NACAAGGCATTGTTGTTGCTATCATTGCTTGCAAGCAGGAATNGCTAATGGAAGACTTCTTTTTTTTTGTGTACTT %/:56465,577-91-265//:######################################################
HWI-EAS283:8:1:1:695#0 133 * 0 0 * * 0 0 AAANCGCTACGTAATGATTGCAGTGAGCACAGAGCGCCCTACTGCACTCCAGCCTGGGAAACAGAGCGCGATTCCG ############################################################################
HWI-EAS283:8:1:1:749#0 99 chr7 91549950 37 76M = 91550245 354 NACCTATCTTAATTACGTTTCAAAGTATATACTCTTTTATAANAAATGAGCTCCATAACTTAAAAGCTAGATAACA %0:<;;9::7779<;;99979707999;::9:;::9:<<75.%*5789197978599################### XT:A:U NM:i:3 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:3 XO:i:0 XG:i:0 MD:Z:0T41C31A1
HWI-EAS283:8:1:1:749#0 147 chr7 91550245 37 17S59M = 91549950 -354 ATTGTGTTAGACCGTGAGTCCATAAAAATATATAGAGGTAATCTGTGGGCGTTTAGTAAATGGTGGTCCTACNACT #####################################################################B6>%42B XT:A:M NM:i:12 SM:i:37 AM:i:37 XM:i:12 XO:i:0 XG:i:0 MD:Z:2A4C9T1T4A5A6C0T0G5T1T0T6T3
HWI-EAS283:8:1:1:1047#0 69 * 0 0 * * 0 0 NTTTTTTGTTCCTTTTTTTTCAAGAGGCCAGAGGCAGAGGCCNTTGTCATTTTCTGTGTGTCCAGGTAATTGCGTA %1:::98789:::999:::::985226#################################################
HWI-EAS283:8:1:1:1047#0 133 * 0 0 * * 0 0 ACCNCGCCTGCCGAGTTTTTCCTTTCTATATTCTTAGTCGTTAAGAATGTTCTATCATGTTGTAATTTTTGTAGTC 0###########################################################################
Typically, the flag field is converted to an integer value for display. You will have to infer the bits set by their sum. In the newest trunk code, you can use "samtools view" with either the "-x" or "-X" for better viewing (C code only).
nilshomer is offline   Reply With Quote
Old 07-28-2009, 09:52 AM   #3
Location: dublin

Join Date: Oct 2008
Posts: 10

Hi nilshomer,
I try "samtools view -x aln.sorted.bam <region>".
but I got this "view: illegal option -- x"
ptong7 is offline   Reply With Quote
Old 07-28-2009, 10:03 AM   #4
Nils Homer
nilshomer's Avatar
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285

Did you download the latest developers version from the trunk (not the release)?
nilshomer is offline   Reply With Quote
Old 07-30-2009, 04:32 AM   #5
Location: dublin

Join Date: Oct 2008
Posts: 10

Thanks nilshomer, It works...
ptong7 is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 01:13 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO