srf format question

[ashah]

the sequence read archive format (srf) looks like this

@ERR007607.1 SOLEXA6_56:5:1:1615:1406 length=50
GTTGACGTTGTTTATCAGCTTTAGTAGTTCTCTGGTGGAACTTTTGGGAT
+ERR007607.1 SOLEXA6_56:5:1:1615:1406 length=50
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

does anyone know of a script or something that will conver these to something more useful (like normal fastq or something)

I'm pretty new to computer science and while I will try to write a perl script myself, I am still finding it difficult.

Thanks in advance!

[kmcarr]

That is a "normal" FASTQ format.

.srf files are a compressed, binary file format, currently only used for uploading data to the SRA. You can't download the srf file, only the sequence extracted from the srf, and that sequence is downloaded in FASTQ format.

What specifically is the problem you are having with the FASTQ files downloaded from SRA?

[ashah]

thanks, I figured out (after carefully reading the FASTQ wikipedia article) that the NCBI sequence read archive format is slightly different than what the eland_standalone program wants... which is quite different.

I can now figure most of this out on my own,
thanks again!