SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Fastest way to extract differing positions from each alignment in a BAM file CHRYSES Bioinformatics 5 12-14-2011 12:28 PM
.SAM to .BAM with SAM file header @PG emilyjia2000 Bioinformatics 13 06-14-2011 01:21 PM
bowtie - invalid CIGAR string - wrong sam format genome Bioinformatics 2 02-16-2011 02:36 PM
gsMapper to SAM/BAM wjeck 454 Pyrosequencing 7 10-14-2010 06:16 AM
bfast localalign looking for the wrong reference file baldeberre Bioinformatics 16 09-17-2010 02:56 PM

Reply
 
Thread Tools
Old 05-22-2012, 12:58 AM   #1
CPCantalapiedra
Member
 
Location: Zaragoza (Spain)

Join Date: Sep 2011
Posts: 38
Default SAM file from gsMapper: wrong positions¿?

Hi,

I am using DataAnalysis_2.6_All_20110523_1850 gsMapper to map some reads to the sequences they come from, so that I know the original position of the reads.

The thing is that for some sequences starting with an homopolymer the BAM file outputs a wrong position while in 454PairAlign it is correct. I think is happening something like:

BAM file:
AAAAAA-----------------------AGTCGGCTAGCGATGCGA
AAAAAAAAAAAAAAAAAGTCGGCTAGCGATGCGA
454PairAlign
______________AAAAAAAGTCGGCTAGCGATGCGA
AAAAAAAAAAAAAAAAAAGTCGGCTAGCGATGCGA

I have searched for this discussion but haven't found anything. Has anyone information about this issue? I am about to write Roche about this bug, cause could be really error prone when working with sequences without knowledge of their actual position, when using the BAM file. But I wanted to ask here before to do that cause likely I am missing something.

thank you
CPCantalapiedra is offline   Reply With Quote
Old 05-23-2012, 06:17 AM   #2
flxlex
Moderator
 
Location: Oslo, Norway

Join Date: Nov 2008
Posts: 415
Default

I got the impression that SAM support for newbler was kind of experimental still. So, please go ahead and report a bug to Roche/454!
flxlex is offline   Reply With Quote
Old 05-23-2012, 06:39 AM   #3
CPCantalapiedra
Member
 
Location: Zaragoza (Spain)

Join Date: Sep 2011
Posts: 38
Default

I have reported it and waiting for appropiate answer. Should I be confident about other files from gsMapper, as 454ReadStatus.txt?

This is from 454ReadStatus.txt
gi|326526112|dbj|AK362029.1|:2996:fwd Full 99 100 gi|326526112|dbj|AK362029.1| 2927 3536 +

This is from 454PairAlign.txt
>gi|326526112|dbj|AK362029.1|:2996:fwd, 1..544 of 544 and gi|326526112|dbj|AK362029.1|, 2997..3536 of 3799 (538/546 ident)


Again, this is for 454PairAlign.txt

>gi|326514771|dbj|AK368544.1|:55:fwd, 1..423 of 423 and gi|326514771|dbj|AK368544.1|, 56..477 of 1340 (422/423 ident)

And this is from 454ReadStatus.txt

gi|326514771|dbj|AK368544.1|:55:fwd Full 100 100 gi|326514771|dbj|AK368544.1| 29 477 +

And from SAM file:
gi|326514771|dbj|AK368544.1|:55:fwd 0 gi|326514771|dbj|AK368544.1| 29 100 5M27D370M1I47M * 0 0 AAAAACCAACCAAATCCTAACTCTGCAACTGCAACTCACCTTGCTTGTCCCCGTTGCCGGCGGCAGCGTCGCCGCCGCGACCGTATCCCTTCGCCTGCGGCGCGAGGACCTGCCCTTTACCTCCGCGCCAGATACGTGCGGCTTGGCCGTGCCAACGCGTTCTCGGGAGTTTTGGATCTTGGTTGTCCTCGTAGCCGCCCCCGCATCCCTATTGCTCGTGCAGTCGTGCTCCTCCAAATTCGCCGGCTGCCGGTGTCCCGGCTCGGCCACAGCCCGCAGTAGGACCATGGTGCTAGAACAGAAAGGAGAAACGTCCAGTGGCATGTATACTTACAAGCATCGTGGTGACAAGGGAGTTGATATCCATGAGATTTTTCGTTAAGAAGAGCAGAACCCGTGTTCTGCTGTCGTATACTGGACTCA AAAA44444@@@@??999AAAAAA99AAAA@@AA?@@@A@A@>>??@@@@=A4444@??@??<<@???@@??@@===@00@@?<>>8<?9;;;>>?9??>?;??>6><?>>:??>>:::;;;>==>??:><??>>9>>:8>>>>>:6699==>=>????>>>>??>>?<<<>>((((??:>>????>><>??>>>>><??=/////5->>;;;>:??>>8?><?>>=>>=>>==>>&>>;;;77>-====><5>>>>=>=888=====<<//*>=>999==<.5;>>=99============;==33399==888;=====;===<=:<<;<<=;;<<33<4<*<<:<<<:4<;;555;8;;;8<;<;;<;<27:#####:90099:99::8:7888444:9:99658888886777578557

I hope someone can confirm I am missing some point.
CPCantalapiedra is offline   Reply With Quote
Reply

Tags
bugs, gsmapper 454 roche, mapping, newbler

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:19 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO