Interrogate .fq file for specific sequence?

[nasepu]

I found a very suspect major snp when digging through my sequence data, identical to a construct I've previously made in the lab. I'm concerned this is contamination, and it has too significant a phenotype to be ignored. The best way I could think to check if the plasmid somehow made its way in is to check for other stuff that would be on a plasmid, like ampicillin or kanamycin resistance.

I'm unsure what the best way to go about this is. I briefly tried aligning the entire .fq file against the amp gene sequence, which threw an error that can probably be fixed, but the whole idea of trying to align billions of reads against one tiny gene rubbed me the wrong way. Is there a better way to go about this/any tools that would be more useful?

[Bukowski]

On the grounds of 'right tool for the right job' using an aligner specifically designed to align ngs reads to a sequence seems like the right way to go to me, as it's likely to be faster than (e.g.) BLAT.

With such a small search space it doesn't seem like the job would take that long - why not try aligning to the vector sequence not just the gene?

[swbarnes2]

Try:

grep AGTTAGCTCTCGATAGGCTAT read1.fq

For whatever sequence you are looking for.