SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
BWA & FASTQ or FASTA kursuni Bioinformatics 29 05-03-2013 05:23 AM
Casava 1.8 Fastq format for using with BWA a14418e10 Bioinformatics 3 11-11-2011 10:13 AM
convert qseq to fastq that maq or bwa can use tgenahmet Bioinformatics 8 02-19-2011 02:13 PM
Qualities in pileup disagree with qualities in fastq swbarnes2 Bioinformatics 10 01-13-2011 04:12 PM
Converting ABI colorspace qualities into base qualities szilva Bioinformatics 7 04-02-2010 12:38 AM

Reply
 
Thread Tools
Old 10-15-2012, 01:29 AM   #1
chris
Member
 
Location: Dundee, Scotland

Join Date: Apr 2008
Posts: 52
Default Problematic Fastq qualities with BWA

Hi all,

I'm having problems running BWA (0.5.9-r16 and 0.6.2) on some new whole exome data.

The initial alignment runs fine (it seems) but when I want to create a SAM file with 'bwa sampe' it screws up the quality scores. Reading the file with samtools gives this error:
Quote:
[samopen] SAM header is present: 25 sequences.
Parse error at line 27: sequence and quality are inconsistent
This is the first sequence line of the SAM file:
Quote:
HISEQ1:382:C14EVACXX:3:1101:1296:1986 83 1 212274224 60 101M = 212274087 -238 AAAGCTGTGGAACGCTACCTCTTCCTTTGAGACCTTGTGGAGAAGGGTCTGAAATGGTAGGCAAAGAGAATAGTTCCCCAGAGAATAAAAACTGGTTGTTG ^_^_$^]^SESC ^\ ^Y# ^_^V^\^W $"#$!#" ^^
^X^^
Compared to an equivalent output from bowtie2:
Quote:
@PG ID:bowtie2 PN:bowtie2 VN:2.0.0-beta7
HISEQ1:382:C14EVACXX:3:1101:1296:1986 83 1 212274224 42 101M = 212274087 -238 AAAGCTGTGGAACGCTACCTCTTCCTTTGAGACCTTGTGGAGAAGGGTCTGAAATGGTAGGCAAAGAGAATAGTTCCCCAGAGAATAAAAACTGGTTGTTG >>C<2;(8B?>5;6(?CABC@BA?=)7=)7;CIIHEHIGIGC=?BD<@GE>GBB3DEF9AIIIIIGGGGHF?D6E9DHGHCHCBIFF<>FHDDB=:;?1 AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP
Anyone else seen this? Is this a problem caused by an incompatibility between BWA and casava 1.8+? I've run BWA in the past with no problems.
TIA
chris is offline   Reply With Quote
Old 10-19-2012, 08:52 AM   #2
chris
Member
 
Location: Dundee, Scotland

Join Date: Apr 2008
Posts: 52
Default

Bump. Am I the only one seeing this?
chris is offline   Reply With Quote
Old 01-15-2013, 01:13 PM   #3
desaila
Junior Member
 
Location: Boston

Join Date: Oct 2010
Posts: 7
Default

I had similar issues with bwa, switched to bowtie2 like you did
desaila is offline   Reply With Quote
Old 01-16-2013, 03:04 AM   #4
TiborNagy
Senior Member
 
Location: Budapest

Join Date: Mar 2010
Posts: 329
Default

Please write down the command line of BWA. Not just the sampe part, but the aln part also. Usually I get this kind of results when I use -I option in bwa aln.
Other tip: See the next line after the error (in your case line 28). Maybe a newline character can be found on your quality score?
TiborNagy is offline   Reply With Quote
Old 01-21-2013, 01:52 AM   #5
chris
Member
 
Location: Dundee, Scotland

Join Date: Apr 2008
Posts: 52
Default

I thought this was a dead thread so didn't update.

Problem is/was the '-I' switch in bwa. It doesn't work with newer sanger fastq format files produced with Illumina pipeline v1.8+: remove switch and it works.
chris is offline   Reply With Quote
Reply

Tags
bowtie2, bwa, exome

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:30 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO