Merged illumina data

[jjk]

I encountered something rather odd and I am not certain that this is an illumina artefact or that it is true what I see.

I was curious if it is possible that when working with RNA sequences, is it possible that two separate RNA strands are merged against each other?

That for example when sequence:

ATGCATGCATGCATGCATGCATGC

and

GATCGATCGATCGATCGATCGATC

become

[Adapter]ATGCATGCATGCATGCATGCATGCGATCGATCGATCGATCGATCGATC[adapter]

[kcchan]

How were these RNA libraries prepared? If the ligation method was used (directional RNA-Seq instead of TruSeq) to add the sequencing adapters, it is possible for two inserts to ligate together during the adapter ligation reaction.

[jjk]

I will look up the exact procedure but what I found out so far is that of the 5.700.000 reads 290.000 of them had this odd result. Which is 5% of the total amount of reads. Would this be a lot if this was an illumina artefact?

[shi]

How did you find those reads which originated from two different strands at the first place?

Wei