SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
BLAST+ creating custom blast database and using blast+ filtering features deniz Bioinformatics 3 07-07-2019 09:04 AM
tophat-fusion-post result, blast database error fengqi Bioinformatics 3 08-05-2013 07:42 PM
BLAST database error - when changing to new BLAST+ local program biobio Bioinformatics 4 06-15-2011 06:20 AM
Local BLAST result annotation kvtspavan Bioinformatics 0 05-25-2011 12:12 AM
BLAST result rdu Bioinformatics 0 04-28-2011 11:22 AM

Reply
 
Thread Tools
Old 08-12-2013, 12:38 PM   #1
lran2008
Member
 
Location: quebec

Join Date: Apr 2013
Posts: 35
Default blast result against rfam database

Hi All,

I am blasting my miRNA-seq fasta file against rFam data base. Here is the command line I used:
blastn -query TOTAL_mapped_reads.fa -task megablast -db Rfam.fasta -out mapped_vs_rfam.txt -outfmt "6 qseqid sseqid qlen evalue pident nident mismatch qcovs qcovhsp"

Then I want to retrive those reads which match tRNAs in rFam.
There are many hits in the output (see the attached picture).

But when I pick the first read which is shown to be 100% match with rRNA in rfam by searching it in rfam website, there is no hit.
>62-796337
TCCCATATGGTCTAGCGGTTAGGATTCCTGGTT

Briefly, according to my blast result against rfam database, there is a match, but when I search the my sequence in online rfam website, there is no hit. So what is the problem?
Attached Images
File Type: jpg 12.jpg (67.9 KB, 31 views)
lran2008 is offline   Reply With Quote
Old 08-12-2013, 11:24 PM   #2
rhinoceros
Senior Member
 
Location: sub-surface moon base

Join Date: Apr 2013
Posts: 372
Default

Based on blastn (at ncbi) your sequence is not a tRNA. The 'best' hit is "PREDICTED: Dasypus novemcinctus WW domain-binding protein 4-like (LOC101430251), transcript variant 2, mRNA".

Perhaps consider a more conservative evalue cutoff? Also, how did you create your Rfam db? "-db Rfam.fasta" looks rather wrong to me but maybe you just named it oddly...
rhinoceros is offline   Reply With Quote
Old 08-13-2013, 05:22 AM   #3
lran2008
Member
 
Location: quebec

Join Date: Apr 2013
Posts: 35
Default

Quote:
Originally Posted by rhinoceros View Post
Based on blastn (at ncbi) your sequence is not a tRNA. The 'best' hit is "PREDICTED: Dasypus novemcinctus WW domain-binding protein 4-like (LOC101430251), transcript variant 2, mRNA".

Perhaps consider a more conservative evalue cutoff? Also, how did you create your Rfam db? "-db Rfam.fasta" looks rather wrong to me but maybe you just named it oddly...
I indeed named it oddly. Anyway, it produced results, but seems to be unreliable... The e value for 62-796337 is 1e-10 in the attached picture. So what's your suggestion for the e value cutoff?
lran2008 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:38 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO