how to delete the all fastq reads which includes a potential 50bp Illumina Single End

rzeng · 09-04-2013, 08:44 AM

HI,

I did Fastqc and found that a potential 50bp illumina single End PCR primer 1 sequence in my reads as followings

AGTTGATCCGGTCCTAGGCAGTGTAGATCTCGGTGGTCGCCGTATCATTA (100% over 30bp)

I checked my reads and found that this 50bp sequence locates on 5' of my reads that account 0.25% of all reads. (also some of my reads that there are GCGCA/GCTCAG/AACCG/AACAAAAGG sequence before this 50bp sequence too))

Since my reads are all 88bp length. I do not want to keep these reads even if I cut these 50bp sequence off.

Anyone know if there is any tools that can get rid of these reads who contain this 50bp sequence in the read? Or anyone has scripts or other ways to do this?

rzeng · 09-04-2013, 08:48 AM

My aim for above question is that I want to get rid of these reads which contain AGTTGATCCGGTCCTAGGCAGTGTAGATCTCGGTGGTCGCCGTATCATTA sequence. since the reads contained this 50bp sequence only account for 0.25%. Fastq toolkit trimmer or other tools can not help.

rhinoceros · 09-04-2013, 09:13 AM

Map your reads against this sequence with something like bowtie2?

rzeng · 09-04-2013, 09:25 AM

No. I need to remove these reads which contain this 50bp sequence noisy from my library before I map them with BWA

GenoMax · 09-04-2013, 09:50 AM

If the reads only account for 0.25% of total why are you worried about them?

kmcarr · 09-04-2013, 10:00 AM

Use a read filtering/trimming application which includes adapter detection and removal. My choice is Trimmomatic.

dariober · 09-04-2013, 10:02 AM

Quote:

Originally Posted by rzeng

My aim for above question is that I want to get rid of these reads which contain AGTTGATCCGGTCCTAGGCAGTGTAGATCTCGGTGGTCGCCGTATCATTA sequence. since the reads contained this 50bp sequence only account for 0.25%. Fastq toolkit trimmer or other tools can not help.

For example I would use cutadapt with "--discard-trimmed" option. Anyway, as GenoMax suggested you might ignore these reads which wouldn't align anyway if the adapter makes up a big chunk of the read.
Dario

FroggyFlox · 09-05-2013, 11:13 AM

If you don't want to deal with Trimmomatic, you can also have a look at the Galaxy platform... Use the tool called 'Manipulate Fastq' which will give you the possibilty to select all the reads containing your sequence and do whatever you want with them, including deleting them.
https://main.g2.bx.psu.edu/

rzeng · 09-05-2013, 11:43 AM

Thank you all the guys

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
deciding 50bp single or paired end on Illumina	Immunologist72	RNA Sequencing	0	10-31-2012 12:22 PM
duplicate reads in Illumina short, single end reads of RNAseq data	inbarpl	Bioinformatics	4	05-22-2012 09:36 AM
detect fusion gene from Solid single end 50bp reads( colorspace)	yinxiaohe	SOLiD	5	12-16-2011 05:39 AM
Fusion gene detect tools for Solid (colorspace)single end 50bp RNA-seq data	yinxiaohe	RNA Sequencing	3	08-22-2011 07:04 PM
illumina single-end reads run cufflink	louis7781x	Bioinformatics	3	04-23-2011 07:05 AM

09-04-2013, 08:44 AM	#1
rzeng Member Location: houston Join Date: Aug 2013 Posts: 19	how to delete the all fastq reads which includes a potential 50bp Illumina Single End HI, I did Fastqc and found that a potential 50bp illumina single End PCR primer 1 sequence in my reads as followings AGTTGATCCGGTCCTAGGCAGTGTAGATCTCGGTGGTCGCCGTATCATTA (100% over 30bp) I checked my reads and found that this 50bp sequence locates on 5' of my reads that account 0.25% of all reads. (also some of my reads that there are GCGCA/GCTCAG/AACCG/AACAAAAGG sequence before this 50bp sequence too)) Since my reads are all 88bp length. I do not want to keep these reads even if I cut these 50bp sequence off. Anyone know if there is any tools that can get rid of these reads who contain this 50bp sequence in the read? Or anyone has scripts or other ways to do this?

09-04-2013, 08:48 AM	#2
rzeng Member Location: houston Join Date: Aug 2013 Posts: 19	My aim for above question is that I want to get rid of these reads which contain AGTTGATCCGGTCCTAGGCAGTGTAGATCTCGGTGGTCGCCGTATCATTA sequence. since the reads contained this 50bp sequence only account for 0.25%. Fastq toolkit trimmer or other tools can not help.

09-04-2013, 09:13 AM	#3
rhinoceros Senior Member Location: sub-surface moon base Join Date: Apr 2013 Posts: 372	Map your reads against this sequence with something like bowtie2?

09-04-2013, 09:25 AM	#4
rzeng Member Location: houston Join Date: Aug 2013 Posts: 19	No. I need to remove these reads which contain this 50bp sequence noisy from my library before I map them with BWA

09-04-2013, 09:50 AM	#5
GenoMax Senior Member Location: East Coast USA Join Date: Feb 2008 Posts: 7,087	If the reads only account for 0.25% of total why are you worried about them?

09-04-2013, 10:00 AM	#6
kmcarr Senior Member Location: USA, Midwest Join Date: May 2008 Posts: 1,178	Use a read filtering/trimming application which includes adapter detection and removal. My choice is Trimmomatic.

09-05-2013, 11:13 AM	#8
FroggyFlox Junior Member Location: Florida, US Join Date: Feb 2012 Posts: 4	If you don't want to deal with Trimmomatic, you can also have a look at the Galaxy platform... Use the tool called 'Manipulate Fastq' which will give you the possibilty to select all the reads containing your sequence and do whatever you want with them, including deleting them. https://main.g2.bx.psu.edu/

09-05-2013, 11:43 AM	#9
rzeng Member Location: houston Join Date: Aug 2013 Posts: 19	Thank you all the guys