SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > SOLiD



Similar Threads
Thread Thread Starter Forum Replies Last Post
problem with simple assembly using Velvet GBishop De novo discovery 4 12-23-2011 06:49 PM
[Velvet,assembly] core dumped occured by runnning velvet matador3000 De novo discovery 0 12-17-2011 08:31 AM
problem for velvet parameters and results hequn Bioinformatics 2 11-17-2011 05:56 AM
Velvet-Oases Memory Problem dacotahm Bioinformatics 0 10-10-2011 10:08 AM
Scaffolding problem with Velvet Melissa Bioinformatics 2 01-05-2010 07:44 PM

Reply
 
Thread Tools
Old 04-10-2012, 10:32 AM   #1
khikho
Junior Member
 
Location: Uppsala

Join Date: Apr 2011
Posts: 2
Default Velvet postprocessing problem

when I run Postprocessor script (version 1.6 ) on my contigs (make them by velvet) I got these bunch of errors which are repeated million times , could you give me hint to handle these errors!?
I don't know which info should I give to make the situation clear so ask me what ever makes it more clear for you!?

Code:
Use of uninitialized value $seq_id in print at Package/denovo_postprocessor_solid_v1.6.pl line 243, <OUT> line 272998.
Use of uninitialized value $seq_id in split at Package/denovo_postprocessor_solid_v1.6.pl line 245, <OUT> line 272998.
Use of uninitialized value $seq in split at Package/denovo_postprocessor_solid_v1.6.pl line 272, <OUT> line 272998.
Use of uninitialized value $seq_id in string at Package/denovo_postprocessor_solid_v1.6.pl line 342, <OUT> line 272998.
Use of uninitialized value $seq in concatenation (.) or string at Package/denovo_postprocessor_solid_v1.6.pl line 343, <OUT> line 272998.
format of input wrong
BTW I plan to assemble human genome.
Thanks
khikho is offline   Reply With Quote
Old 04-11-2012, 05:17 AM   #2
colindaven
Senior Member
 
Location: Germany

Join Date: Oct 2008
Posts: 415
Default

It's an input format error. I think this package requires an older version of Velvet.

Why not try assembling a small subset of reads with the older Velvet version and seeing if you can get that to run ?
colindaven is offline   Reply With Quote
Old 04-11-2012, 07:19 AM   #3
sisch
Member
 
Location: Dusseldorf, Germany

Join Date: Jun 2011
Posts: 29
Default

Could be an issue with the fasta headers. Could you post the first two contigs including the headers from your contigs.fa file?
sisch is offline   Reply With Quote
Old 04-16-2012, 04:43 AM   #4
khikho
Junior Member
 
Location: Uppsala

Join Date: Apr 2011
Posts: 2
Default

>NODE_5_length_25_cov_2.560000
GGAAGGGCCCAAGCAACATATGGGATCGAAGAGAGCCCAGCACGGACTC
>NODE_7_length_25_cov_2.240000
AAACTAAACAAAACTAAACTAAACGAAACTAGACTAAACTAAACTAGAC
>NODE_10_length_25_cov_7.920000
GAAGGGCCACTTGGCAGCGAAGTGAAGAGTATCCAGCCGAGACGGTTCg
>NODE_35_length_44_cov_7.863636
TAACATAACATAAATCCAGTTAACATAACGTAACTAAAACTAATATAAACTAAACTAAGGTACACTAA
khikho is offline   Reply With Quote
Old 04-16-2012, 06:22 AM   #5
sisch
Member
 
Location: Dusseldorf, Germany

Join Date: Jun 2011
Posts: 29
Default

It seems you're trying to postprocess basespace data (as you posted) with a colorspace script (postprocessor_SOLID_v1.6.pl).

However, I'm lacking experience with the postprocessor script, so this is the only hint I can give.
sisch is offline   Reply With Quote
Old 04-18-2012, 03:15 PM   #6
jjjscuedu
Member
 
Location: NY

Join Date: Mar 2012
Posts: 35
Default velveth Kmer length

Hi all,

I was trying to use the velveth to analysis my RNAseq dataset.

My reads length is 101.

However, when I try to set the Kmer of velveth to 81, there is a problem:

velveth cannot handle the kmer as long as 81.


Hence, i want to ask what the reasonable value for kmer for the read length.

Thanks!

Jingjing
jjjscuedu is offline   Reply With Quote
Old 04-19-2012, 12:15 AM   #7
colindaven
Senior Member
 
Location: Germany

Join Date: Oct 2008
Posts: 415
Default

jjjscuedu:

Try first trimming the low quality read ends. Use FastQC to visualise.

Then we have used successfully used kmer parameters between 33 and 45 for reads of that length. We could test values quite easily because we knew the expected genome sizes of 20 bacterial genomes, and tried to maximise for that.
colindaven is offline   Reply With Quote
Reply

Tags
solid, velvet, whole genome sequencing

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:37 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO