count reads number in collapsed file

lran2008 · 07-30-2013, 10:06 AM

Hi all,

I used bowtie to align a collapsed fasta file to the bovine genome and get a fasta file (mapped.fa) including all the mapped reads. But this mapped.fa is also a collapsed file. So how could I get the total reads number in mapped.fa, instead of the unique reads number?

Thanks.

Ran

Heisman · 07-30-2013, 10:43 AM

What do you mean by "collapsed"? Could you copy and paste the exact commands that were run?

lran2008 · 07-30-2013, 11:34 AM

Hi Heisman, thanks for your reply. The collapsed file included the unique reads:

>1-30176523
TCAGTGCACTACAGAACTTTGT
>2-17234938
TTCAAGTAATCCAGGATAGGCT
>5-10273189
TACCCTGTAGAACCGAATTTGT
>6-10202799
TGAGATGAAGCACTGTAGCT
>7-7833696
TGAGATGAAGCACTGTAGCTCT
>8-7677783
TGTAAACATCCTCGACTGGA
>9-7403197
TGTAAACATCCTCGACTGGAAGCT
>10-5760993
TGGGGGGCCCAAGTCCTTCTGATCGAGGCC

So here I can get the number of total unique reads. But each unique read represents thousands of reads. How could I get the total number of the redundant reads in this file?

Thanks!

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
Count the Number of Paired-End Reads Mapped by Tophat	Fernas	Bioinformatics	5	10-23-2015 03:26 AM
Count number of reads in peaks?	albireo	Bioinformatics	4	04-13-2013 07:51 PM
How to count number of mapped paired-end and single-end rna-seq reads	repinementer	Bioinformatics	8	01-06-2013 06:06 AM
Count unique reads in a FASTQ file	id0	Bioinformatics	2	10-24-2012 02:01 AM
cufflinks with collapsed reads files	SongLi	Bioinformatics	0	11-19-2010 12:10 PM

07-30-2013, 10:06 AM	#1
lran2008 Member Location: quebec Join Date: Apr 2013 Posts: 35	count reads number in collapsed file Hi all, I used bowtie to align a collapsed fasta file to the bovine genome and get a fasta file (mapped.fa) including all the mapped reads. But this mapped.fa is also a collapsed file. So how could I get the total reads number in mapped.fa, instead of the unique reads number? Thanks. Ran

07-30-2013, 10:43 AM	#2
Heisman Senior Member Location: St. Louis Join Date: Dec 2010 Posts: 535	What do you mean by "collapsed"? Could you copy and paste the exact commands that were run?

07-30-2013, 11:34 AM	#3
lran2008 Member Location: quebec Join Date: Apr 2013 Posts: 35	Hi Heisman, thanks for your reply. The collapsed file included the unique reads: >1-30176523 TCAGTGCACTACAGAACTTTGT >2-17234938 TTCAAGTAATCCAGGATAGGCT >5-10273189 TACCCTGTAGAACCGAATTTGT >6-10202799 TGAGATGAAGCACTGTAGCT >7-7833696 TGAGATGAAGCACTGTAGCTCT >8-7677783 TGTAAACATCCTCGACTGGA >9-7403197 TGTAAACATCCTCGACTGGAAGCT >10-5760993 TGGGGGGCCCAAGTCCTTCTGATCGAGGCC So here I can get the number of total unique reads. But each unique read represents thousands of reads. How could I get the total number of the redundant reads in this file? Thanks!