SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Repost: tophat-fusion outputs empty result mrfox Bioinformatics 31 10-13-2016 08:03 AM
Tophat2 returns empty junction file: Warning: junction database is empty! sachitad Bioinformatics 4 02-15-2013 01:40 AM
bwa question on file outputs/inputs ikrier Bioinformatics 12 10-12-2012 09:22 AM
the meaning of CIGAR column in SAM file outputs by BWA holywoool Bioinformatics 2 01-04-2011 05:34 AM
Aligner that outputs H2 flag in SAM file phalaenopsis Bioinformatics 0 08-04-2010 06:14 AM

Reply
 
Thread Tools
Old 08-11-2014, 01:23 PM   #1
leontp587
Junior Member
 
Location: US

Join Date: Jul 2014
Posts: 6
Default bowtie2 outputs empty file

I'm trying to align a paired reads fastq file to the hg19 genome using bowtie2 in Galaxy. The paired ends files are the output of a fastq groomer and are about 3GB each and contains reads like these:

@ERR010982.1460.2 SOLEXA-GA01_1:1:1:21:1187 length=76
AGTTATGATTTTTGTTAGTCTTTTTGTCTTATTATTCTTCCTTAGGATTATAACAACTACTCTAACCTTTTGTTCT
+ERR010982.1460.2 SOLEXA-GA01_1:1:1:21:1187 length=76
!"""!""!""""""""!"!"""""""!"""""""""""""""""""""!!"!"""!!"!!!!!!!!!!!!!!!!!!

The bowtie2 syntax as run by galaxy is:
bowtie2-build "/home/leon/ref_data/fa/hg19.fa" genome; ln -s "/home/leon/ref_data/fa/hg19.fa" genome.fa; bowtie2 -p ${GALAXY_SLOTS:-4} -x genome -1 /home/leon/galaxy-dist/database/files/000/dataset_19.dat -2 /home/leon/galaxy-dist/database/files/000/dataset_20.dat -I 0 -X 250 | samtools view -Su - | samtools sort -o - - > /home/leon/galaxy-dist/database/files/000/dataset_21.dat

For some reason, the bam file that's generated after this runs for several hours is only 62 bytes long, meaning nothing got aligned! What could I be doing wrong? This is the first time I'm aligning a genome and so could be royally screwing things up.
leontp587 is offline   Reply With Quote
Old 08-12-2014, 07:51 AM   #2
westerman
Rick Westerman
 
Location: Purdue University, Indiana, USA

Join Date: Jun 2008
Posts: 1,104
Default

Probably better to post this to the Galaxy forum.

I am unsure which Galaxy instance you are using but my first observation is that you are trying to build the index for a commonly used genome -- hg19. Why not use the built-in index? My suspicion is that if you are using the public Galaxy instance that you are running out disk space or time when building the index.
westerman is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:47 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO