Extract reads from paired-end fastq based on specific adapters with bbduk

gspirito · 11-08-2019, 02:53 AM

Hello everyone, I am using bbduk.sh (from bbmap toolkit) to extract reads from paired-end fastq files based on the presence of specific adapters in the 5' of the sequence in the "_1" fastq file.

I am using this command:

Code:

./bbmap/bbduk.sh -Xmx1g in1=reads_1.fastq.gz in2=reads_2.fastq.gz outm1=matched1.fastq.gz outm2=matched2.fastq.gz literal=AAACCTGAGAAACCTA k=16 hdist=0 -rcomp=f

The problem is that other that the correct reads, the output file contains also other reads which do not include the adapter sequence, es:

# from reads_1.fastq.gz
@SRR9262917.232075 232075/1
GCATGCGAGTAGCGGTGGTTCTTATA
+
FFFFFFFFFFFFFFFFFFFFFFFFFF

# from reads_2.fastq.gz
@SRR9262917.232075 232075/2
AAGCAGTGGTATCAACGCAGAGTACATGGGATTCCATAGCCCTGTGGTTTTTATAGATCTTGTAAACCCCAAACCTGGGAAACCTAGTGGC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFF,FFFFFFFFF

Does anyone know why this may be happening and how to avoid this?

Thanks in advance.

GenoMax · 11-08-2019, 06:32 AM

You could add a "restrictleft=N" N=certain number of bases to look only in that area. Also adding "minlength=N" will exclude small reads like the first example. Also try setting k to something smaller (8) so it has better chances of matching correctly.

I hope "-rcomp=f" is a typo. There should be no - at beginning.

gspirito · 11-12-2019, 07:37 AM

Thank you! That worked

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
How to extract uniquely mapped paired end reads from bam file	serenaliao	RNA Sequencing	0	08-20-2014 11:42 AM
What do I do with my paired end reads after removing the adapters?	prs321	Bioinformatics	4	01-14-2014 12:20 PM
Extract paired end reads from sff file.	ojy	Bioinformatics	4	12-13-2012 05:07 AM
Can we extract f3 reads while f5 reads are being sequenced in paired end	Raa	Bioinformatics	2	12-25-2011 09:46 PM
How to extract paired-end reads from .sff 454?	pmiguel	Bioinformatics	8	02-22-2010 09:17 AM

11-08-2019, 02:53 AM	#1
gspirito Junior Member Location: Italy Join Date: Nov 2019 Posts: 2	Extract reads from paired-end fastq based on specific adapters with bbduk Hello everyone, I am using bbduk.sh (from bbmap toolkit) to extract reads from paired-end fastq files based on the presence of specific adapters in the 5' of the sequence in the "_1" fastq file. I am using this command: Code: ./bbmap/bbduk.sh -Xmx1g in1=reads_1.fastq.gz in2=reads_2.fastq.gz outm1=matched1.fastq.gz outm2=matched2.fastq.gz literal=AAACCTGAGAAACCTA k=16 hdist=0 -rcomp=f The problem is that other that the correct reads, the output file contains also other reads which do not include the adapter sequence, es: # from reads_1.fastq.gz @SRR9262917.232075 232075/1 GCATGCGAGTAGCGGTGGTTCTTATA + FFFFFFFFFFFFFFFFFFFFFFFFFF # from reads_2.fastq.gz @SRR9262917.232075 232075/2 AAGCAGTGGTATCAACGCAGAGTACATGGGATTCCATAGCCCTGTGGTTTTTATAGATCTTGTAAACCCCAAACCTGGGAAACCTAGTGGC + FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFF,FFFFFFFFF Does anyone know why this may be happening and how to avoid this? Thanks in advance.

11-08-2019, 06:32 AM	#2
GenoMax Senior Member Location: East Coast USA Join Date: Feb 2008 Posts: 7,087	You could add a "restrictleft=N" N=certain number of bases to look only in that area. Also adding "minlength=N" will exclude small reads like the first example. Also try setting k to something smaller (8) so it has better chances of matching correctly. I hope "-rcomp=f" is a typo. There should be no - at beginning. Last edited by GenoMax; 11-08-2019 at 06:44 AM.

11-12-2019, 07:37 AM	#3
gspirito Junior Member Location: Italy Join Date: Nov 2019 Posts: 2	Thank you! That worked