SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
ChIP-Seq: Enabling Data Analysis on High-Throughput Data in Large Data Depository Usi Newsbot! Literature Watch 1 04-18-2018 10:50 PM
problem on file format in ChIP-Seq data analysis sp_wade Bioinformatics 5 03-08-2012 06:43 AM
[NGS - analysis of gene expression data] Machine Learning + RNAseq data Chuckytah Bioinformatics 7 03-05-2012 04:16 AM
RNA-seq analysis raw data format neetu Bioinformatics 8 10-14-2011 03:23 AM
Looking process to convert gff3 format into ace format or sam format andylai Bioinformatics 1 05-17-2011 03:09 AM

Reply
 
Thread Tools
Old 06-19-2012, 08:48 PM   #1
bostonian
Junior Member
 
Location: Boston

Join Date: Jun 2012
Posts: 4
Default data format and how to analysis

Hi,

I am a complete newbie, so please bear with me if my question seems too silly.

I recently downloaded a RNAseq dataset from GEO, it contains paired data files, and in the following format:

readID Seq 0-mi**** 1-mi**** 2-mi**** chr start end strand
HWUSI-EAS230-R:2:99:1151:1802#0/1 GAGCTCATTGGTGGCGTGGTGGCCTTGACCTTCCGG 1 0 0 chr10 70914936 70914971 -
HWUSI-EAS230-R:2:44:642:495#0/1 TTGGCTGCCTTCTGGGGTGAACTTTCTGCTATTTCC 0 0 1 chr7 47298110 47298145 -

......

I googled around but could not figure out what format it is, and how to proceed to analyze. My goal is to produce gene expression values (RPKM) from these data files.

Thanks so much for your help.
bostonian is offline   Reply With Quote
Old 06-20-2012, 02:13 PM   #2
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,479
Default

It'd help if you mentioned the GEO accession number. They probably mention more about the format in the GEO entry. If nothing else, you could probably convert that to SAM/BAM format (the difficulty being whether or not the mappings are actually unique) and then calculate the RPKM. Alternatively, if they provide no further information (or the original fastq file), you could convert that to a multi-fasta file and then realign it.
dpryan is offline   Reply With Quote
Old 06-22-2012, 06:40 AM   #3
bostonian
Junior Member
 
Location: Boston

Join Date: Jun 2012
Posts: 4
Default

Hi, Thanks a lot for your response. The dataset is GSE22260. I do not see any mentioning about the data formet, but maybe it is only because I do not know where to look. Could you also advise how to convert what I have to SAM/BAM format? or how to convert to multi-fasta files? I am fairly familiar with R, so I am hoping I will be able figure the later analysis after I have data in BAM format. Thanks again.
bostonian is offline   Reply With Quote
Old 06-22-2012, 08:01 AM   #4
westerman
Rick Westerman
 
Location: Purdue University, Indiana, USA

Join Date: Jun 2008
Posts: 1,104
Default

I believe that these are output from "Illumina Genome Analyzer Pipeline". I am not sure if there is a converter from this format to SAM/BAM. Multi-fastA would be trivial. Something like:

cut -f 1,2 file.name | sed -e 's/^/>/' -e 's/\t/\n' > output.file

or

perl -nale 'print ">$F[0]\n$F[1]"' file.name > output.file

Then you could map the reads against a current human genome and go from there.
westerman is offline   Reply With Quote
Old 06-22-2012, 08:40 AM   #5
bostonian
Junior Member
 
Location: Boston

Join Date: Jun 2012
Posts: 4
Default

Thank, Rick. I am trying to avoid doing alignment myself. Since each sequence comes with chromosome number and genomic coordinates in the data file, I assume they are already aligned (?). Is there any tool that I can use to convert the data into some format so that I can read them into some R packages, such as ShortRead or others (?), for further analysis?
bostonian is offline   Reply With Quote
Old 06-22-2012, 08:53 AM   #6
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,479
Default

As Rick suggested and they state in the data processing section of each sample, the files are from the Genome Analyzer Pipeline (there are two files for each sample, since this is paired-end data). If you were willing to redo the alignment, you can download the reads from SRA and convert them to fastq with fastq-dump. Alternatively, it wouldn't be difficult to write a small program in perl/python/R/whatever to read in both read files at once and output to SAM. Just make sure that corresponding lines in each file are actually meant to go together (that is, ensure that read names match), as if they kept reads where only one end maps then you would otherwise get really screwy results. So, just put a * in the base quality field and make up an appropriate fake MAPQ value along with the correct flag and you're good to go.
dpryan is offline   Reply With Quote
Old 06-22-2012, 10:22 AM   #7
westerman
Rick Westerman
 
Location: Purdue University, Indiana, USA

Join Date: Jun 2008
Posts: 1,104
Default

@bostonian

I do not use ShortRead however reading the manual ShortRead uses the readAligned part of bioconductor. I am not sure that readAligned will read in your file directly however the fields are similar and I suspect that with some simple data manipulation you could get them read in.


BTW: It is this type of data manipulation that makes bioinformatics such a joy. :-)
westerman is offline   Reply With Quote
Old 10-18-2013, 04:36 AM   #8
rboettcher
Member
 
Location: Berlin

Join Date: Oct 2010
Posts: 71
Default

@bostonian

I am currently struggling with the same issue, did you find a solution for your problem?
rboettcher is offline   Reply With Quote
Reply

Tags
analysis, data format, geo database, rna seq

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:29 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO